Rh2BG226800

Defensin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0009981
Physical Location & Seq
Reverse (-)
22079421 .. 22106140
26720 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG226800.1

Sequence Viewer

Length: 210 bp
ATGGACGCAACATCACAAGTTTTCGCAGAAATTGCAAGTGCTCAAGGTTCAAGGTGTTGCATCAATCATCCCAAGCTTGGAAATTGTGTGCCTGGTACAGATGACAACCCAGAGAAAAATGGAAAGTGCTGGGTGTATTGCATTGAAGAGTGTAAAGGAGGAATCTGCAAAAACGTAGGCTCTCATCATGAGTGTCATTGCATGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

69

Amino Acids

7.46

Weight (kDa)

6.01

Isoelectric Point (pI)

45.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 18 - 69 2.6e-11 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 2 cut(s) 51, 146
AjnI CCWGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw21I GWGCWC 1 cut(s) 43
Bbv12I GWGCWC 1 cut(s) 43
BciT130I CCWGG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 69
BpuEI CTTGAG 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse3DI GCAATG 1 cut(s) 196
BseBI CCWGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMI GCAATG 1 cut(s) 196
BseYI CCCAGC 1 cut(s) 129
BsiHKAI GWGCWC 1 cut(s) 43
BslI CCNNNNNNNGG 1 cut(s) 77
Bsp1286I GDGCHC 1 cut(s) 43
BspHI TCATGA 1 cut(s) 187
BsrDI GCAATG 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 93
Bst6I CTCTTC 1 cut(s) 141
BstAPI GCANNNNNTGC 1 cut(s) 32
BstF5I GGATG 1 cut(s) 67
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 93
BstNSI RCATGY 1 cut(s) 205
BstSCI CCNGG 1 cut(s) 91
BtsCI GGATG 1 cut(s) 67
CciI TCATGA 1 cut(s) 187
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 96
CviAII CATG 2 cut(s) 188, 202
CviJI RGCY 2 cut(s) 76, 180
CviKI_1 RGCY 2 cut(s) 76, 180
CviQI GTAC 1 cut(s) 96
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 91
FaeI CATG 2 cut(s) 191, 205
FaiI YATR 2 cut(s) 189, 203
FatI CATG 2 cut(s) 187, 201
FokI GGATG 1 cut(s) 54
GsaI CCCAGC 1 cut(s) 133
HgaI GACGC 1 cut(s) 14
Hin1II CATG 2 cut(s) 191, 205
HindIII AAGCTT 1 cut(s) 74
HinfI GANTC 1 cut(s) 162
Hpy188III TCNNGA 1 cut(s) 188
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 5 cut(s) 35, 60, 141, 168, 201
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 2 cut(s) 191, 205
LpnPI CCDG 4 cut(s) 78, 105, 115, 123
LweI GCATC 1 cut(s) 69
MaeII ACGT 1 cut(s) 174
MboII GAAGA 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 2 cut(s) 30, 82
MnlI CCTC 1 cut(s) 152
MspR9I CCNGG 1 cut(s) 93
MvaI CCWGG 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 32
NlaIII CATG 2 cut(s) 191, 205
NspI RCATGY 1 cut(s) 205
PagI TCATGA 1 cut(s) 187
PfeI GAWTC 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 91
PspFI CCCAGC 1 cut(s) 129
PspGI CCWGG 1 cut(s) 91
RsaI GTAC 1 cut(s) 97
RsaNI GTAC 1 cut(s) 96
ScrFI CCNGG 1 cut(s) 93
SduI GDGCHC 1 cut(s) 43
SetI ASST 4 cut(s) 49, 56, 78, 177
SfaNI GCATC 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 42
SmoI CTYRAG 1 cut(s) 42
Sse9I AATT 2 cut(s) 30, 82
StyD4I CCNGG 1 cut(s) 91
TaiI ACGT 1 cut(s) 177
TasI AATT 2 cut(s) 30, 82
TfiI GAWTC 1 cut(s) 162
XceI RCATGY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.