MD15G1119700.v1.1

Defensin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0009981
Physical Location & Seq
Reverse (-)
8615438 .. 8616292
855 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1119700.v1.1.491

Sequence Viewer

Length: 237 bp
ATGAATAAGTTTACAATCACATCTTTCCTCCTTGTGTTGGTGCTTTTGTCAAGCTCCACAGTTTGCAAGATTTCAATTGCTCAAGCTTCAAGGTGCTGTAATAATCACCCCGAGCAAGGAAAAGAAAAAGGAAAATGTGAGGATGGAAAGTGCAGGGAATTCTGCATTGCAGATTGTGAGAAAGGAGGTTTCTGCAAAAAGATTAGCTCTGGCCCTGTATGCCATTGCTACTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Defensin_like

Protein Analysis

79

Amino Acids

8.53

Weight (kDa)

8.52

Isoelectric Point (pI)

29.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 31 - 78 1.6e-10 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 158
AfiI CCNNNNNNNGG 2 cut(s) 37, 116
AgsI TTSAA 2 cut(s) 75, 90
AluBI AGCT 3 cut(s) 54, 86, 207
AluI AGCT 3 cut(s) 54, 86, 207
Ama87I CYCGRG 1 cut(s) 110
AoxI GGCC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 212
AsuHPI GGTGA 1 cut(s) 98
AvaI CYCGRG 1 cut(s) 110
BccI CCATC 1 cut(s) 137
BmeT110I CYCGRG 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 212
BpuEI CTTGAG 1 cut(s) 66
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 116
Bse3DI GCAATG 2 cut(s) 165, 223
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 2 cut(s) 37, 116
BseMI GCAATG 2 cut(s) 165, 223
BsgI GTGCAG 1 cut(s) 172
BshFI GGCC 1 cut(s) 213
BsiHKCI CYCGRG 1 cut(s) 110
BslI CCNNNNNNNGG 2 cut(s) 37, 116
BsnI GGCC 1 cut(s) 213
BsoBI CYCGRG 1 cut(s) 110
BspANI GGCC 1 cut(s) 213
BsrDI GCAATG 2 cut(s) 165, 223
Bst4CI ACNGT 2 cut(s) 61, 233
BstF5I GGATG 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 219
BsuRI GGCC 1 cut(s) 213
BtsCI GGATG 1 cut(s) 148
Cfr13I GGNCC 1 cut(s) 212
CviJI RGCY 4 cut(s) 54, 86, 207, 213
CviKI_1 RGCY 4 cut(s) 54, 86, 207, 213
Eco88I CYCGRG 1 cut(s) 110
EcoRI GAATTC 1 cut(s) 158
FaiI YATR 1 cut(s) 220
FokI GGATG 1 cut(s) 155
HaeIII GGCC 1 cut(s) 213
HindIII AAGCTT 1 cut(s) 84
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 12
Hpy8I GTNNAC 1 cut(s) 12
HpyCH4III ACNGT 2 cut(s) 61, 233
HpyCH4V TGCA 5 cut(s) 66, 153, 165, 170, 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 219
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 3 cut(s) 139, 195, 228
MfeI CAATTG 1 cut(s) 75
MluCI AATT 2 cut(s) 75, 158
MnlI CCTC 3 cut(s) 38, 133, 179
MunI CAATTG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 219
PspPI GGNCC 1 cut(s) 212
Sau96I GGNCC 1 cut(s) 212
SetI ASST 5 cut(s) 56, 88, 95, 190, 209
SmlI CTYRAG 1 cut(s) 81
SmoI CTYRAG 1 cut(s) 81
Sse9I AATT 2 cut(s) 75, 158
TaaI ACNGT 2 cut(s) 61, 233
TasI AATT 2 cut(s) 75, 158
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.