AT4G38060

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0002086
Physical Location & Seq
Reverse (-)
17873001 .. 17875268
2268 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G38060.2

Sequence Viewer

Length: 378 bp
ATGATGAAGAGACCGATCCCAAGTTGGCCATGGTGGTTATTAGGAAGTAGAAAAGAGAAAGAAACTGAAGCTCTTAAGTTTCCTACAAAGATAGCTCGAGTAAATAAGAGGAAAGAGCTTGAACTTGAGAGCTTTGGTTCGTCTGGCTCTGAATCTGTAGATGTTGTTGCTGGTGATGGACCTGAATGGTCTGTTGGATGGACTGAGCCACATGGACCTGATTTCCAAAGTGATGATGAAGGAAATGATGGTGGCTTCTTAGTGTTGGTTCCTTGTTATAGAGCTGTTGTTGAAGGCTCTAGTAATAATAATAACCAGCTCTTGAGTGCTGTCAAGAATCTCCCCAATGGTTTGCCTCCTGGTATGAATCACCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.75

Weight (kDa)

5.15

Isoelectric Point (pI)

36.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 10
AcoI YGGCCR 1 cut(s) 26
AcuI CTGAAG 1 cut(s) 87
AflII CTTAAG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 122, 293
AjnI CCWGG 1 cut(s) 358
AjuI GAANNNNNNNTTGG 2 cut(s) 177, 209
AluBI AGCT 6 cut(s) 71, 95, 118, 132, 284, 319
AluI AGCT 6 cut(s) 71, 95, 118, 132, 284, 319
Alw26I GTCTC 1 cut(s) 4
AlwI GGATC 1 cut(s) 10
Ama87I CYCGRG 1 cut(s) 96
AoxI GGCC 1 cut(s) 26
AspS9I GGNCC 2 cut(s) 179, 215
AsuHPI GGTGA 2 cut(s) 185, 362
AvaI CYCGRG 1 cut(s) 96
AvaII GGWCC 2 cut(s) 179, 215
BalI TGGCCA 1 cut(s) 28
BccI CCATC 3 cut(s) 170, 192, 242
BciT130I CCWGG 1 cut(s) 360
BcoDI GTCTC 1 cut(s) 4
BfaI CTAG 1 cut(s) 300
BfmI CTRYAG 1 cut(s) 156
BfrI CTTAAG 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 360
Bme18I GGWCC 2 cut(s) 179, 215
BmeT110I CYCGRG 1 cut(s) 96
BmgT120I GGNCC 2 cut(s) 179, 215
BmiI GGNNCC 1 cut(s) 270
BmrFI CCNGG 1 cut(s) 360
BpuEI CTTGAG 2 cut(s) 146, 343
BsaI GGTCTC 1 cut(s) 4
BsaJI CCNNGG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 360
BseDI CCNNGG 1 cut(s) 29
BseGI GGATG 1 cut(s) 203
BseMII CTCAG 1 cut(s) 195
BshFI GGCC 1 cut(s) 28
BsiHKCI CYCGRG 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 4
BsnI GGCC 1 cut(s) 28
Bso31I GGTCTC 1 cut(s) 4
BsoBI CYCGRG 1 cut(s) 96
Bsp143I GATC 1 cut(s) 15
Bsp19I CCATGG 1 cut(s) 29
BspANI GGCC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 270
BspPI GGATC 1 cut(s) 10
BspTI CTTAAG 1 cut(s) 74
BspTNI GGTCTC 1 cut(s) 4
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 1 cut(s) 15
BssT1I CCWWGG 1 cut(s) 29
Bst2UI CCWGG 1 cut(s) 360
Bst6I CTCTTC 1 cut(s) 2
BstAFI CTTAAG 1 cut(s) 74
BstDEI CTNAG 2 cut(s) 204, 259
BstDSI CCRYGG 1 cut(s) 29
BstF5I GGATG 1 cut(s) 203
BstKTI GATC 1 cut(s) 18
BstMAI GTCTC 1 cut(s) 4
BstMBI GATC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 360
BstSCI CCNGG 1 cut(s) 358
BstSFI CTRYAG 1 cut(s) 156
BsuRI GGCC 1 cut(s) 28
BtgI CCRYGG 1 cut(s) 29
BtsCI GGATG 1 cut(s) 203
Cfr13I GGNCC 2 cut(s) 179, 215
CviAII CATG 2 cut(s) 30, 212
DdeI CTNAG 2 cut(s) 204, 259
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
EaeI YGGCCR 1 cut(s) 26
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
Eco130I CCWWGG 1 cut(s) 29
Eco31I GGTCTC 1 cut(s) 4
Eco47I GGWCC 2 cut(s) 179, 215
Eco57I CTGAAG 1 cut(s) 87
Eco88I CYCGRG 1 cut(s) 96
EcoRII CCWGG 1 cut(s) 358
EcoT14I CCWWGG 1 cut(s) 29
ErhI CCWWGG 1 cut(s) 29
FaeI CATG 2 cut(s) 33, 215
FaiI YATR 4 cut(s) 31, 213, 279, 365
FatI CATG 2 cut(s) 29, 211
FokI GGATG 1 cut(s) 210
FspBI CTAG 1 cut(s) 300
HaeIII GGCC 1 cut(s) 28
Hin1II CATG 2 cut(s) 33, 215
HinfI GANTC 3 cut(s) 152, 337, 367
HphI GGTGA 2 cut(s) 185, 362
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 322, 334
HpyAV CCTTC 2 cut(s) 233, 287
HpyF3I CTNAG 2 cut(s) 204, 259
Hsp92II CATG 2 cut(s) 33, 215
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 7 cut(s) 129, 156, 195, 231, 329, 345, 372
MaeI CTAG 1 cut(s) 300
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 1 cut(s) 19
MlsI TGGCCA 1 cut(s) 28
MluNI TGGCCA 1 cut(s) 28
MmeI TCCRAC 1 cut(s) 175
MnlI CCTC 2 cut(s) 102, 366
Mox20I TGGCCA 1 cut(s) 28
MscI TGGCCA 1 cut(s) 28
MseI TTAA 1 cut(s) 75
Msp20I TGGCCA 1 cut(s) 28
MspCI CTTAAG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 360
MvaI CCWGG 1 cut(s) 360
NcoI CCATGG 1 cut(s) 29
NdeII GATC 1 cut(s) 15
NlaIII CATG 2 cut(s) 33, 215
NlaIV GGNNCC 1 cut(s) 270
PaeR7I CTCGAG 1 cut(s) 96
PfeI GAWTC 3 cut(s) 152, 337, 367
Psp6I CCWGG 1 cut(s) 358
PspGI CCWGG 1 cut(s) 358
PspN4I GGNNCC 1 cut(s) 270
PspPI GGNCC 2 cut(s) 179, 215
PspXI VCTCGAGB 1 cut(s) 96
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 179, 215
ScrFI CCNGG 1 cut(s) 360
SetI ASST 8 cut(s) 73, 97, 120, 134, 184, 220, 286, 321
SfcI CTRYAG 1 cut(s) 156
Sfr274I CTCGAG 1 cut(s) 96
SinI GGWCC 2 cut(s) 179, 215
SlaI CTCGAG 1 cut(s) 96
SmlI CTYRAG 4 cut(s) 74, 96, 125, 322
SmoI CTYRAG 4 cut(s) 74, 96, 125, 322
SspMI CTAG 1 cut(s) 300
StyD4I CCNGG 1 cut(s) 358
StyI CCWWGG 1 cut(s) 29
TaqI TCGA 1 cut(s) 97
TaqII GACCGA 1 cut(s) 28
TfiI GAWTC 3 cut(s) 152, 337, 367
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TspDTI ATGAA 2 cut(s) 20, 252
Vha464I CTTAAG 1 cut(s) 74
VpaK11BI GGWCC 2 cut(s) 179, 215
XcmI CCANNNNNNNNNTGG 1 cut(s) 27
XhoI CTCGAG 1 cut(s) 96
XspI CTAG 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.