Rmu_sc0021708.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021708.1
Physical Location & Seq
Reverse (-)
25023 .. 27116
2094 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021708.1_g000003.1.cds

Sequence Viewer

Length: 510 bp
atggctttggcttttaccaatctttcgtggtggttgtggagtggaaagcagaaggagcctagaatctctaatggaacctgtttaaattcttcccctgaatcgggtttgtgggaatctgatgcattaaagtttccttcggttaaaggggccaatatggcttcatctagaaaggtgaagcggaaatggcatagtcgggaagaaaggaaaattgatagggaatatgatggtgttctcattccatctgatggagagtgtgtttctggttctgaatctgacgattcggattggtcaattggatggttggagcctcatggacctgggttccagagtgaagatgatgcagatgatagtttcgctgtgctggttccatgctatgggcatgctattcatgatatggtggggaaatcgaagaacaaagatcagaatactattgggagcatcccagatggttattcagatgagagcaagaaatttatggaagagtggctctcttccctaaggaacagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

169

Amino Acids

18.91

Weight (kDa)

5.0

Isoelectric Point (pI)

50.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 245, 374
AciI CCGC 1 cut(s) 178
AcsI RAATTY 2 cut(s) 85, 470
AfiI CCNNNNNNNGG 4 cut(s) 100, 101, 245, 374
AjnI CCWGG 1 cut(s) 316
AluBI AGCT 1 cut(s) 507
AluI AGCT 1 cut(s) 507
AoxI GGCC 1 cut(s) 147
ApoI RAATTY 2 cut(s) 85, 470
AspS9I GGNCC 2 cut(s) 147, 314
AsuHPI GGTGA 1 cut(s) 184
AvaII GGWCC 1 cut(s) 314
AxyI CCTNAGG 1 cut(s) 497
BccI CCATC 5 cut(s) 218, 239, 247, 291, 440
BciT130I CCWGG 1 cut(s) 318
BfaI CTAG 2 cut(s) 60, 165
BglI GCCNNNNNGGC 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 318
Bme18I GGWCC 1 cut(s) 314
BmgT120I GGNCC 2 cut(s) 147, 314
BmiI GGNNCC 6 cut(s) 57, 76, 148, 306, 323, 366
BmrFI CCNGG 1 cut(s) 318
BmsI GCATC 3 cut(s) 109, 328, 447
BplI GAGNNNNNCTC 2 cut(s) 473, 505
BsaJI CCNNGG 1 cut(s) 317
BsaXI ACNNNNNCTCC 2 cut(s) 240, 270
Bsc4I CCNNNNNNNGG 4 cut(s) 100, 101, 245, 374
Bse21I CCTNAGG 1 cut(s) 497
BseBI CCWGG 1 cut(s) 318
BseDI CCNNGG 1 cut(s) 317
BseGI GGATG 2 cut(s) 302, 438
BseLI CCNNNNNNNGG 4 cut(s) 100, 101, 245, 374
BshFI GGCC 1 cut(s) 149
BslI CCNNNNNNNGG 4 cut(s) 100, 101, 245, 374
BsnI GGCC 1 cut(s) 149
Bsp143I GATC 1 cut(s) 418
BspACI CCGC 1 cut(s) 178
BspANI GGCC 1 cut(s) 149
BspHI TCATGA 1 cut(s) 388
BspLI GGNNCC 6 cut(s) 57, 76, 148, 306, 323, 366
BssECI CCNNGG 1 cut(s) 317
BssMI GATC 1 cut(s) 418
Bst2UI CCWGG 1 cut(s) 318
Bst6I CTCTTC 2 cut(s) 474, 496
BstC8I GCNNGC 1 cut(s) 381
BstDEI CTNAG 1 cut(s) 497
BstF5I GGATG 2 cut(s) 302, 438
BstKTI GATC 1 cut(s) 421
BstMBI GATC 1 cut(s) 418
BstMWI GCNNNNNNNGC 3 cut(s) 55, 155, 184
BstNI CCWGG 1 cut(s) 318
BstNSI RCATGY 1 cut(s) 383
BstSCI CCNGG 1 cut(s) 316
Bsu36I CCTNAGG 1 cut(s) 497
BsuRI GGCC 1 cut(s) 149
BtsCI GGATG 2 cut(s) 302, 438
Cac8I GCNNGC 1 cut(s) 381
CciI TCATGA 1 cut(s) 388
Cfr13I GGNCC 2 cut(s) 147, 314
CviAII CATG 4 cut(s) 311, 369, 380, 389
CviJI RGCY 8 cut(s) 5, 11, 58, 149, 158, 307, 487, 507
CviKI_1 RGCY 8 cut(s) 5, 11, 58, 149, 158, 307, 487, 507
DdeI CTNAG 1 cut(s) 497
DpnI GATC 1 cut(s) 420
DpnII GATC 1 cut(s) 418
DraI TTTAAA 1 cut(s) 84
Eam1104I CTCTTC 2 cut(s) 474, 496
EarI CTCTTC 2 cut(s) 474, 496
Eco47I GGWCC 1 cut(s) 314
Eco81I CCTNAGG 1 cut(s) 497
EcoRII CCWGG 1 cut(s) 316
EcoT22I ATGCAT 1 cut(s) 124
FaeI CATG 4 cut(s) 314, 372, 383, 392
FatI CATG 4 cut(s) 310, 368, 379, 388
FokI GGATG 2 cut(s) 309, 425
FspBI CTAG 2 cut(s) 60, 165
HaeIII GGCC 1 cut(s) 149
Hin1II CATG 4 cut(s) 314, 372, 383, 392
HinfI GANTC 5 cut(s) 63, 98, 113, 269, 278
HphI GGTGA 1 cut(s) 184
Hpy188I TCNGA 7 cut(s) 118, 244, 268, 274, 283, 423, 457
Hpy188III TCNNGA 4 cut(s) 165, 194, 325, 389
HpyAV CCTTC 2 cut(s) 46, 144
HpyCH4V TGCA 2 cut(s) 122, 341
HpyF10VI GCNNNNNNNGC 3 cut(s) 55, 155, 184
HpyF3I CTNAG 1 cut(s) 497
Hsp92II CATG 4 cut(s) 314, 372, 383, 392
Kzo9I GATC 1 cut(s) 418
LmnI GCTCC 3 cut(s) 55, 304, 435
LpnPI CCDG 8 cut(s) 91, 108, 246, 303, 330, 338, 347, 456
LweI GCATC 3 cut(s) 109, 328, 447
MaeI CTAG 2 cut(s) 60, 165
MalI GATC 1 cut(s) 420
MboI GATC 1 cut(s) 418
MboII GAAGA 6 cut(s) 81, 209, 344, 421, 483, 491
MfeI CAATTG 1 cut(s) 291
MluCI AATT 4 cut(s) 85, 207, 291, 470
MmeI TCCRAC 1 cut(s) 282
MnlI CCTC 1 cut(s) 318
Mph1103I ATGCAT 1 cut(s) 124
MseI TTAA 3 cut(s) 83, 125, 141
MspA1I CMGCKG 1 cut(s) 507
MspR9I CCNGG 1 cut(s) 318
MunI CAATTG 1 cut(s) 291
MvaI CCWGG 1 cut(s) 318
MwoI GCNNNNNNNGC 3 cut(s) 55, 155, 184
NdeII GATC 1 cut(s) 418
NlaIII CATG 4 cut(s) 314, 372, 383, 392
NlaIV GGNNCC 6 cut(s) 57, 76, 148, 306, 323, 366
NsiI ATGCAT 1 cut(s) 124
NspI RCATGY 1 cut(s) 383
PaeI GCATGC 1 cut(s) 383
PagI TCATGA 1 cut(s) 388
PfeI GAWTC 5 cut(s) 63, 98, 113, 269, 278
PflMI CCANNNNNTGG 2 cut(s) 245, 374
Psp6I CCWGG 1 cut(s) 316
PspGI CCWGG 1 cut(s) 316
PspN4I GGNNCC 6 cut(s) 57, 76, 148, 306, 323, 366
PspPI GGNCC 2 cut(s) 147, 314
PvuII CAGCTG 1 cut(s) 507
SaqAI TTAA 3 cut(s) 83, 125, 141
Sau3AI GATC 1 cut(s) 418
Sau96I GGNCC 2 cut(s) 147, 314
ScrFI CCNGG 1 cut(s) 318
SetI ASST 4 cut(s) 80, 174, 319, 509
SfaNI GCATC 3 cut(s) 109, 328, 447
SinI GGWCC 1 cut(s) 314
SphI GCATGC 1 cut(s) 383
Sse9I AATT 4 cut(s) 85, 207, 291, 470
SsiI CCGC 1 cut(s) 178
SspMI CTAG 2 cut(s) 60, 165
StyD4I CCNGG 1 cut(s) 316
TaqI TCGA 1 cut(s) 407
TasI AATT 4 cut(s) 85, 207, 291, 470
TfiI GAWTC 5 cut(s) 63, 98, 113, 269, 278
Tru1I TTAA 3 cut(s) 83, 125, 141
Tru9I TTAA 3 cut(s) 83, 125, 141
TspDTI ATGAA 2 cut(s) 150, 377
Van91I CCANNNNNTGG 2 cut(s) 245, 374
VpaK11BI GGWCC 1 cut(s) 314
XapI RAATTY 2 cut(s) 85, 470
XbaI TCTAGA 1 cut(s) 164
XceI RCATGY 1 cut(s) 383
XspI CTAG 2 cut(s) 60, 165
Zsp2I ATGCAT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.