pycom08g17050

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0002086
Physical Location & Seq
Forward (+)
17232178 .. 17234166
1989 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g17050.2

Sequence Viewer

Length: 516 bp
ATGGCTGTGGCTTTTACCCAGCTTTCATGGTCGTTGTGGAGTGGAAGGCAAAAAGAGCCTATAGTCCCAAAGGGGTCCTCTTTAAATTCTTCCCCTGAATCGGGCATGCGGGAAACTGATACGTTAAAGTTTTCTTCGGTGAAGGGGTCAAATATGGCCTCATCATCGTCGAGAAGGGTGAGGCGCAAATGGCGTAGTCGGGAAGAACGGAAAATTGATAGGGAATTTGACGTTGTTCTTGTGCCATCTGAGGGTGTATGTGTTTCTGGTTCTGAATCTGAGGACTCCGATTGGTCGGTTGGATGGTTGGAGCCTCTTGGACCTGGGTTCCCTAGTGATGACGATGCAGACGATAGTTTTGCCGTGCTGGTTCCATGCTATGGCCATGTTATTCATGACATGGTGAAGGATTCAATGAACAATTTCTTGAGCACTGTTGGGAACATCCCGGATGGTTATTCAGATGAGAGCACGAAATATATGGAAGAGTGGCTCTCTTCTCTGAGAAACAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

172

Amino Acids

19.05

Weight (kDa)

4.8

Isoelectric Point (pI)

60.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 380
AciI CCGC 1 cut(s) 109
AcoI YGGCCR 1 cut(s) 382
AcsI RAATTY 2 cut(s) 85, 224
AfiI CCNNNNNNNGG 4 cut(s) 100, 101, 251, 380
AgsI TTSAA 1 cut(s) 414
AjnI CCWGG 1 cut(s) 322
AluBI AGCT 2 cut(s) 22, 513
AluI AGCT 2 cut(s) 22, 513
Alw21I GWGCWC 2 cut(s) 434, 473
AoxI GGCC 2 cut(s) 156, 382
ApoI RAATTY 2 cut(s) 85, 224
ArsI GACNNNNNNTTYG 2 cut(s) 341, 373
Asp700I GAANNNNTTC 1 cut(s) 422
AspLEI GCGC 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 75, 320
AsuC2I CCSGG 1 cut(s) 449
AsuHPI GGTGA 3 cut(s) 151, 190, 415
AvaII GGWCC 2 cut(s) 75, 320
BalI TGGCCA 1 cut(s) 384
Bbv12I GWGCWC 2 cut(s) 434, 473
BccI CCATC 3 cut(s) 253, 297, 446
BceAI ACGGC 1 cut(s) 347
BcgI CGANNNNNNTGC 2 cut(s) 341, 375
BciT130I CCWGG 1 cut(s) 324
BcnI CCSGG 1 cut(s) 449
BfaI CTAG 1 cut(s) 333
BfmI CTRYAG 1 cut(s) 60
Bme1390I CCNGG 2 cut(s) 324, 449
Bme18I GGWCC 2 cut(s) 75, 320
BmgT120I GGNCC 2 cut(s) 75, 320
BmiI GGNNCC 4 cut(s) 76, 312, 329, 372
BmrFI CCNGG 2 cut(s) 324, 449
BmsI GCATC 1 cut(s) 334
BplI GAGNNNNNCTC 2 cut(s) 479, 511
BpuEI CTTGAG 1 cut(s) 448
BpuMI CCSGG 1 cut(s) 449
BsaJI CCNNGG 1 cut(s) 323
Bsc4I CCNNNNNNNGG 4 cut(s) 100, 101, 251, 380
BseBI CCWGG 1 cut(s) 324
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 3 cut(s) 308, 444, 457
BseLI CCNNNNNNNGG 4 cut(s) 100, 101, 251, 380
BseMII CTCAG 3 cut(s) 240, 270, 494
BseYI CCCAGC 1 cut(s) 18
BshFI GGCC 2 cut(s) 158, 384
BsiHKAI GWGCWC 2 cut(s) 434, 473
BsiSI CCGG 1 cut(s) 449
BslFI GGGAC 1 cut(s) 50
BslI CCNNNNNNNGG 4 cut(s) 100, 101, 251, 380
BsmFI GGGAC 1 cut(s) 50
BsnI GGCC 2 cut(s) 158, 384
Bsp1286I GDGCHC 2 cut(s) 434, 473
BspACI CCGC 1 cut(s) 109
BspANI GGCC 2 cut(s) 158, 384
BspCNI CTCAG 3 cut(s) 241, 271, 495
BspHI TCATGA 1 cut(s) 394
BspLI GGNNCC 4 cut(s) 76, 312, 329, 372
BssECI CCNNGG 1 cut(s) 323
Bst2UI CCWGG 1 cut(s) 324
Bst4CI ACNGT 1 cut(s) 436
Bst6I CTCTTC 2 cut(s) 480, 502
BstC8I GCNNGC 1 cut(s) 107
BstDEI CTNAG 3 cut(s) 249, 279, 503
BstF5I GGATG 3 cut(s) 308, 444, 457
BstHHI GCGC 1 cut(s) 186
BstMWI GCNNNNNNNGC 2 cut(s) 55, 190
BstNI CCWGG 1 cut(s) 324
BstNSI RCATGY 1 cut(s) 109
BstSCI CCNGG 2 cut(s) 322, 447
BstSFI CTRYAG 1 cut(s) 60
BsuRI GGCC 2 cut(s) 158, 384
BtsCI GGATG 3 cut(s) 308, 444, 457
BtsIMutI CAGTG 1 cut(s) 432
Cac8I GCNNGC 1 cut(s) 107
CciI TCATGA 1 cut(s) 394
CfoI GCGC 1 cut(s) 186
Cfr13I GGNCC 2 cut(s) 75, 320
CviAII CATG 6 cut(s) 27, 106, 375, 386, 395, 400
CviJI RGCY 9 cut(s) 5, 11, 22, 58, 158, 313, 384, 493, 513
CviKI_1 RGCY 9 cut(s) 5, 11, 22, 58, 158, 313, 384, 493, 513
DdeI CTNAG 3 cut(s) 249, 279, 503
DraI TTTAAA 1 cut(s) 84
EaeI YGGCCR 1 cut(s) 382
Eam1104I CTCTTC 2 cut(s) 480, 502
EarI CTCTTC 2 cut(s) 480, 502
Eco47I GGWCC 2 cut(s) 75, 320
EcoO109I RGGNCCY 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 322
FaeI CATG 6 cut(s) 30, 109, 378, 389, 398, 403
FaqI GGGAC 1 cut(s) 50
FatI CATG 6 cut(s) 26, 105, 374, 385, 394, 399
FauI CCCGC 1 cut(s) 102
FokI GGATG 3 cut(s) 315, 431, 464
FspBI CTAG 1 cut(s) 333
GlaI GCGC 1 cut(s) 185
GsaI CCCAGC 1 cut(s) 22
HaeIII GGCC 2 cut(s) 158, 384
HapII CCGG 1 cut(s) 449
HhaI GCGC 1 cut(s) 186
Hin1II CATG 6 cut(s) 30, 109, 378, 389, 398, 403
Hin6I GCGC 1 cut(s) 184
HinP1I GCGC 1 cut(s) 184
HinfI GANTC 4 cut(s) 98, 275, 284, 410
HpaII CCGG 1 cut(s) 449
HphI GGTGA 3 cut(s) 151, 190, 415
Hpy188I TCNGA 6 cut(s) 250, 274, 280, 289, 463, 504
Hpy188III TCNNGA 4 cut(s) 171, 200, 395, 427
Hpy99I CGWCG 1 cut(s) 172
HpyAV CCTTC 4 cut(s) 39, 136, 168, 400
HpyCH4III ACNGT 1 cut(s) 436
HpyCH4IV ACGT 2 cut(s) 122, 231
HpyCH4V TGCA 1 cut(s) 347
HpyF10VI GCNNNNNNNGC 2 cut(s) 55, 190
HpyF3I CTNAG 3 cut(s) 249, 279, 503
HpySE526I ACGT 2 cut(s) 122, 231
Hsp92II CATG 6 cut(s) 30, 109, 378, 389, 398, 403
HspAI GCGC 1 cut(s) 184
LmnI GCTCC 1 cut(s) 310
LpnPI CCDG 7 cut(s) 32, 108, 252, 309, 336, 353, 462
LweI GCATC 1 cut(s) 334
MaeI CTAG 1 cut(s) 333
MaeII ACGT 2 cut(s) 122, 231
MboII GAAGA 5 cut(s) 81, 126, 215, 489, 497
MhlI GDGCHC 2 cut(s) 434, 473
MlsI TGGCCA 1 cut(s) 384
MluCI AATT 4 cut(s) 85, 213, 224, 421
MluNI TGGCCA 1 cut(s) 384
MlyI GAGTC 1 cut(s) 278
MmeI TCCRAC 2 cut(s) 280, 288
MnlI CCTC 6 cut(s) 88, 169, 174, 244, 274, 324
Mox20I TGGCCA 1 cut(s) 384
MroXI GAANNNNTTC 1 cut(s) 422
MscI TGGCCA 1 cut(s) 384
MseI TTAA 2 cut(s) 83, 125
Msp20I TGGCCA 1 cut(s) 384
MspA1I CMGCKG 1 cut(s) 513
MspI CCGG 1 cut(s) 449
MspR9I CCNGG 2 cut(s) 324, 449
MvaI CCWGG 1 cut(s) 324
MwoI GCNNNNNNNGC 2 cut(s) 55, 190
NciI CCSGG 1 cut(s) 449
NlaIII CATG 6 cut(s) 30, 109, 378, 389, 398, 403
NlaIV GGNNCC 4 cut(s) 76, 312, 329, 372
NspI RCATGY 1 cut(s) 109
PaeI GCATGC 1 cut(s) 109
PagI TCATGA 1 cut(s) 394
PcsI WCGNNNNNNNCGW 1 cut(s) 348
PdmI GAANNNNTTC 1 cut(s) 422
PfeI GAWTC 3 cut(s) 98, 275, 410
PflMI CCANNNNNTGG 1 cut(s) 380
PfoI TCCNGGA 1 cut(s) 447
PleI GAGTC 1 cut(s) 278
PpsI GAGTC 1 cut(s) 278
PpuMI RGGWCCY 1 cut(s) 75
Psp5II RGGWCCY 1 cut(s) 75
Psp6I CCWGG 1 cut(s) 322
PspFI CCCAGC 1 cut(s) 18
PspGI CCWGG 1 cut(s) 322
PspN4I GGNNCC 4 cut(s) 76, 312, 329, 372
PspPI GGNCC 2 cut(s) 75, 320
PspPPI RGGWCCY 1 cut(s) 75
PvuII CAGCTG 1 cut(s) 513
SaqAI TTAA 2 cut(s) 83, 125
Sau96I GGNCC 2 cut(s) 75, 320
SchI GAGTC 1 cut(s) 278
ScrFI CCNGG 2 cut(s) 324, 449
SduI GDGCHC 2 cut(s) 434, 473
SetI ASST 5 cut(s) 24, 125, 234, 325, 515
SfaNI GCATC 1 cut(s) 334
SfcI CTRYAG 1 cut(s) 60
SinI GGWCC 2 cut(s) 75, 320
SmlI CTYRAG 1 cut(s) 427
SmoI CTYRAG 1 cut(s) 427
SphI GCATGC 1 cut(s) 109
Sse9I AATT 4 cut(s) 85, 213, 224, 421
SsiI CCGC 1 cut(s) 109
SspMI CTAG 1 cut(s) 333
StyD4I CCNGG 2 cut(s) 322, 447
TaaI ACNGT 1 cut(s) 436
TaiI ACGT 2 cut(s) 125, 234
TaqI TCGA 1 cut(s) 170
TasI AATT 4 cut(s) 85, 213, 224, 421
TfiI GAWTC 3 cut(s) 98, 275, 410
Tru1I TTAA 2 cut(s) 83, 125
Tru9I TTAA 2 cut(s) 83, 125
TscAI CASTG 1 cut(s) 439
TspDTI ATGAA 3 cut(s) 15, 383, 431
TspGWI ACGGA 1 cut(s) 223
TspRI CASTG 1 cut(s) 439
Van91I CCANNNNNTGG 1 cut(s) 380
VpaK11BI GGWCC 2 cut(s) 75, 320
XapI RAATTY 2 cut(s) 85, 224
XceI RCATGY 1 cut(s) 109
XmnI GAANNNNTTC 1 cut(s) 422
XspI CTAG 1 cut(s) 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.