Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0004210

Physical Location & Seq

Genomic Coordinates Forward (+)

7935316 .. 7937405

Gene Structure 2090 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT5G23535.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 480 bp

ATGGGCTGGAAAGCTGCTGAGAAACTCATCAGACACTGGAAGATACTTCGAGGAGACAATGTAATGATAATTCGTGGGAAAGATAAGGGTGAGACTGGAACCATAAAGCGTGTCATTCGATCCCAAAATCGTGTCATCGTTGAAGGGAAGAATCTGATCAAGAAACATATAAAGGGAGGCCCTGATCACGAAGGTGGAATTTTCACTGTAGAGGCTCCTCTTCACGCCTCAAATGTCCAAGTTGTTGATCCTGTCACTGGGAGGCCTTGTAAGGTTGGTGTAAAATACCTAGAAGATGGAACAAAAGTAAGAGTAGCCAGAGGCACTGGCACATCTGGTTCCATAATTCCCCGACCAGAGATTCTAAAGATAAGGGCAACGCCGCGACCCACAACTGCTGGCCCTAAGGACACACCAATGGAGTTTGTCTGGGAGCAGACATATGATGCTAAAACTGGAAAGGGCATGCCTGATCTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

KOW ribosomal_L24

Protein Analysis

159

Amino Acids

17.5

Weight (kDa)

10.04

Isoelectric Point (pI)

18.16

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
KOW	PF00467	17 - 48	2.6e-10	KOW motif
ribosomal_L24	PF17136	51 - 111	4.7e-21	Large ribosomal subunit protein uL24, C-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004210)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G23535 AT5G23535
fragaria_vesca	FvH4_2g23200
malus_domestica	MD03G1261300.v1.1 MD11G1281700.v1.1
prunus_persica	Prupe.1G577100_v2.0.a1 Prupe.1G577100_v2.0.a1 Prupe.8G237600_v2.0.a1 Prupe.8G237600_v2.0.a1
pyrus_communis	pycom03g20930 pycom11g24980
rosa_chinensis	RchiOBHm_Chr1g0329981 RchiOBHm_Chr6g0290451
rosa_laevigata	RLG00000012214 RLG00000029859
rosa_multiflora	Rmu_sc0000499.1_g000005 Rmu_sc0002890.1_g000007 Rmu_sc0009365.1_g000007 Rmu_sc0009365.1_g000020
rosa_roxburghii	Rroxscaffold_7G00177050
rosa_rugosa	Rorug01G0083600 Rorug01G0083700 Rorug01G0083800 Rorug01G0083900 Rorug01G0085000 Rorug01G0085100 Rorug06G0212800
rosa_samantha	Rh1BG081000 Rh6CG336500 Rh6DG323400
rosa_wichuraiana	Rw0G022380 Rw1G008290 Rw6G028000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	385
AciI	CCGC	1 cut(s)	383
AclWI	GGATC	2 cut(s)	114, 242
AcsI	RAATTY	1 cut(s)	198
AfiI	CCNNNNNNNGG	1 cut(s)	257
AgsI	TTSAA	1 cut(s)	143
AleI	CACNNNNGTG	1 cut(s)	192
AluBI	AGCT	1 cut(s)	14
AluI	AGCT	1 cut(s)	14
Alw26I	GTCTC	2 cut(s)	48, 86
AlwI	GGATC	2 cut(s)	114, 242
AlwNI	CAGNNNCTG	1 cut(s)	36
AoxI	GGCC	3 cut(s)	178, 263, 400
ApeKI	GCWGC	1 cut(s)	14
ApoI	RAATTY	1 cut(s)	198
AspS9I	GGNCC	2 cut(s)	179, 401
AsuHPI	GGTGA	1 cut(s)	101
AxyI	CCTNAGG	1 cut(s)	405
BccI	CCATC	1 cut(s)	290
BclI	TGATCA	2 cut(s)	156, 184
BcoDI	GTCTC	2 cut(s)	48, 86
BfaI	CTAG	1 cut(s)	290
BfmI	CTRYAG	1 cut(s)	207
BisI	GCNGC	2 cut(s)	15, 383
BlsI	GCNGC	2 cut(s)	16, 384
BmgT120I	GGNCC	2 cut(s)	179, 401
BmiI	GGNNCC	3 cut(s)	100, 216, 340
BmrI	ACTGGG	1 cut(s)	267
BmsI	GCATC	1 cut(s)	436
BmuI	ACTGGG	1 cut(s)	267
BsaXI	ACNNNNNCTCC	4 cut(s)	45, 75, 253, 283
Bsc4I	CCNNNNNNNGG	1 cut(s)	257
Bse1I	ACTGG	5 cut(s)	41, 100, 262, 331, 460
Bse21I	CCTNAGG	1 cut(s)	405
BseLI	CCNNNNNNNGG	1 cut(s)	257
BseMII	CTCAG	1 cut(s)	9
BseNI	ACTGG	5 cut(s)	41, 100, 262, 331, 460
BseRI	GAGGAG	2 cut(s)	66, 207
Bsh1236I	CGCG	1 cut(s)	385
BshFI	GGCC	3 cut(s)	180, 265, 402
BslI	CCNNNNNNNGG	1 cut(s)	257
BsmAI	GTCTC	2 cut(s)	48, 86
BsnI	GGCC	3 cut(s)	180, 265, 402
Bsp143I	GATC	5 cut(s)	119, 156, 184, 247, 472
BspACI	CCGC	1 cut(s)	383
BspANI	GGCC	3 cut(s)	180, 265, 402
BspCNI	CTCAG	1 cut(s)	10
BspFNI	CGCG	1 cut(s)	385
BspLI	GGNNCC	3 cut(s)	100, 216, 340
BspPI	GGATC	2 cut(s)	114, 242
BsrI	ACTGG	5 cut(s)	41, 100, 262, 331, 460
BssMI	GATC	5 cut(s)	119, 156, 184, 247, 472
Bst4CI	ACNGT	1 cut(s)	208
Bst6I	CTCTTC	1 cut(s)	225
BstC8I	GCNNGC	2 cut(s)	400, 467
BstDEI	CTNAG	2 cut(s)	18, 405
BstFNI	CGCG	1 cut(s)	385
BstKTI	GATC	5 cut(s)	122, 159, 187, 250, 475
BstMAI	GTCTC	2 cut(s)	48, 86
BstMBI	GATC	5 cut(s)	119, 156, 184, 247, 472
BstNSI	RCATGY	1 cut(s)	469
BstSFI	CTRYAG	1 cut(s)	207
BstUI	CGCG	1 cut(s)	385
Bsu36I	CCTNAGG	1 cut(s)	405
BsuRI	GGCC	3 cut(s)	180, 265, 402
BtsIMutI	CAGTG	4 cut(s)	34, 204, 255, 324
Cac8I	GCNNGC	2 cut(s)	400, 467
CaiI	CAGNNNCTG	1 cut(s)	36
Cfr13I	GGNCC	2 cut(s)	179, 401
CviAII	CATG	1 cut(s)	466
CviJI	RGCY	7 cut(s)	6, 14, 180, 215, 265, 317, 402
CviKI_1	RGCY	7 cut(s)	6, 14, 180, 215, 265, 317, 402
DdeI	CTNAG	2 cut(s)	18, 405
DpnI	GATC	5 cut(s)	121, 158, 186, 249, 474
DpnII	GATC	5 cut(s)	119, 156, 184, 247, 472
Eam1104I	CTCTTC	1 cut(s)	225
EarI	CTCTTC	1 cut(s)	225
Eco147I	AGGCCT	1 cut(s)	265
Eco81I	CCTNAGG	1 cut(s)	405
EcoO109I	RGGNCCY	1 cut(s)	179
FaeI	CATG	1 cut(s)	469
FaiI	YATR	7 cut(s)	104, 168, 170, 344, 442, 444, 467
FatI	CATG	1 cut(s)	465
FauNDI	CATATG	1 cut(s)	442
FbaI	TGATCA	2 cut(s)	156, 184
Fnu4HI	GCNGC	2 cut(s)	15, 383
Fsp4HI	GCNGC	2 cut(s)	15, 383
FspBI	CTAG	1 cut(s)	290
GluI	GCNGC	2 cut(s)	15, 383
HaeIII	GGCC	3 cut(s)	180, 265, 402
Hin1II	CATG	1 cut(s)	469
HinfI	GANTC	2 cut(s)	151, 361
HphI	GGTGA	1 cut(s)	101
Hpy188I	TCNGA	2 cut(s)	32, 156
Hpy188III	TCNNGA	2 cut(s)	160, 188
HpyAV	CCTTC	2 cut(s)	137, 185
HpyCH4III	ACNGT	1 cut(s)	208
HpyF3I	CTNAG	2 cut(s)	18, 405
Hsp92II	CATG	1 cut(s)	469
Ksp22I	TGATCA	2 cut(s)	156, 184
Kzo9I	GATC	5 cut(s)	119, 156, 184, 247, 472
LmnI	GCTCC	2 cut(s)	220, 433
LweI	GCATC	1 cut(s)	436
MaeI	CTAG	1 cut(s)	290
MaeIII	GTNAC	1 cut(s)	253
MalI	GATC	5 cut(s)	121, 158, 186, 249, 474
MboI	GATC	5 cut(s)	119, 156, 184, 247, 472
MboII	GAAGA	4 cut(s)	52, 160, 212, 305
MluCI	AATT	3 cut(s)	69, 198, 345
MnlI	CCTC	7 cut(s)	44, 170, 205, 228, 238, 255, 314
MslI	CAYNNNNRTG	2 cut(s)	192, 416
MvnI	CGCG	1 cut(s)	385
NdeI	CATATG	1 cut(s)	442
NdeII	GATC	5 cut(s)	119, 156, 184, 247, 472
NlaIII	CATG	1 cut(s)	469
NlaIV	GGNNCC	3 cut(s)	100, 216, 340
NmuCI	GTSAC	1 cut(s)	253
NspI	RCATGY	1 cut(s)	469
OliI	CACNNNNGTG	1 cut(s)	192
PaeI	GCATGC	1 cut(s)	469
PceI	AGGCCT	1 cut(s)	265
PfeI	GAWTC	2 cut(s)	151, 361
PkrI	GCNGC	2 cut(s)	16, 384
PspN4I	GGNNCC	3 cut(s)	100, 216, 340
PspPI	GGNCC	2 cut(s)	179, 401
PstNI	CAGNNNCTG	1 cut(s)	36
RseI	CAYNNNNRTG	2 cut(s)	192, 416
SatI	GCNGC	2 cut(s)	15, 383
Sau3AI	GATC	5 cut(s)	119, 156, 184, 247, 472
Sau96I	GGNCC	2 cut(s)	179, 401
SetI	ASST	4 cut(s)	16, 196, 276, 291
SfaNI	GCATC	1 cut(s)	436
SfcI	CTRYAG	1 cut(s)	207
SmiMI	CAYNNNNRTG	2 cut(s)	192, 416
SphI	GCATGC	1 cut(s)	469
Sse9I	AATT	3 cut(s)	69, 198, 345
SseBI	AGGCCT	1 cut(s)	265
SsiI	CCGC	1 cut(s)	383
SspMI	CTAG	1 cut(s)	290
StuI	AGGCCT	1 cut(s)	265
TaaI	ACNGT	1 cut(s)	208
TaqI	TCGA	2 cut(s)	49, 118
TasI	AATT	3 cut(s)	69, 198, 345
TauI	GCSGC	1 cut(s)	385
TfiI	GAWTC	2 cut(s)	151, 361
TscAI	CASTG	4 cut(s)	41, 211, 262, 331
TseFI	GTSAC	1 cut(s)	253
TseI	GCWGC	1 cut(s)	14
Tsp45I	GTSAC	1 cut(s)	253
TspRI	CASTG	4 cut(s)	41, 211, 262, 331
XapI	RAATTY	1 cut(s)	198
XceI	RCATGY	1 cut(s)	469
XspI	CTAG	1 cut(s)	290

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.