Rorug01G0083700

Belongs to the universal ribosomal protein uL24 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0004210
Physical Location & Seq
Reverse (-)
13619152 .. 13620506
1355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0083700.1

Sequence Viewer

Length: 669 bp
ATGGAAATAATACCAAGGACTCAAGGAGCAGCGAATCGGCAGTGGTGGGTGCCATCTTCAACTTCAGGTACAATCAAGTGTCCGTGTAAAAGGTGTCATAATGGCTACAATAGACTGCCTGCTGTTGTTGAGCAGCATCTTAGGGTGGATGGCATGGATCCGAAATATGTTAACATCCCCTGGACCGAGCATGGTGAGCATTTACCAGCTGCAGTTGATCATAATATGGCAGGGCCTTCATCATATCAACCAGATTTTAATTTGCCAGGACCGTCGTCACATCAACCAGATTCTGATGTGCAAGATATGTTGCACGATACATTTGGCATGTATGAAGGTGAAGATGATTTACAAGAACCAGCAGAGCCTACTGAAGGTCCATCCTTGCCTAACGGCCCTACCCCTGATGCACAAAGATTTTACCAGCTTTTAGAAAAAGCTGACACTGAATTATACCCTGGTGCAGGAAAAAAGATGTTCGATTTTTTGATAAAGCTATATCAAATAAAAGCATTGAACAGTTGGAGTGATGTATCGTTCACACAGTTGCTTGAATTGATAAAGGCTTATTTGCCCCCAGGGGAAACTCTTCCTGCTTCCTTCTATTTAACAAAAAAGTTCATCAAAAGTCTTGGGTTAACTAAGAAGCCTAAACTGACACCTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
KOW ribosomal_L24

Protein Analysis

222

Amino Acids

24.84

Weight (kDa)

5.62

Isoelectric Point (pI)

41.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transpos_assoc PF13963 20 - 66 5.4e-10 Transposase-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 49
AclWI GGATC 2 cut(s) 152, 165
AcuI CTGAAG 2 cut(s) 48, 393
AfaI GTAC 1 cut(s) 70
AfiI CCNNNNNNNGG 2 cut(s) 374, 464
AgsI TTSAA 3 cut(s) 60, 517, 554
AjnI CCWGG 4 cut(s) 179, 265, 457, 577
AluBI AGCT 4 cut(s) 209, 427, 440, 496
AluI AGCT 4 cut(s) 209, 427, 440, 496
AlwI GGATC 2 cut(s) 152, 165
AlwNI CAGNNNCTG 1 cut(s) 293
AoxI GGCC 2 cut(s) 233, 394
ApeKI GCWGC 3 cut(s) 29, 133, 209
Asp700I GAANNNNTTC 1 cut(s) 588
AspS9I GGNCC 5 cut(s) 183, 233, 269, 377, 395
AsuHPI GGTGA 2 cut(s) 206, 350
AvaII GGWCC 3 cut(s) 183, 269, 377
BamHI GGATCC 1 cut(s) 157
BanI GGYRCC 1 cut(s) 49
BarI GAAGNNNNNNTAC 2 cut(s) 333, 365
BbvI GCAGC 3 cut(s) 41, 145, 196
BccI CCATC 3 cut(s) 61, 143, 388
BceAI ACGGC 1 cut(s) 409
BciT130I CCWGG 4 cut(s) 181, 267, 459, 579
BclI TGATCA 1 cut(s) 217
BfmI CTRYAG 1 cut(s) 210
BisI GCNGC 3 cut(s) 30, 134, 210
BlsI GCNGC 3 cut(s) 31, 135, 211
Bme1390I CCNGG 4 cut(s) 181, 267, 459, 579
Bme18I GGWCC 3 cut(s) 183, 269, 377
BmgT120I GGNCC 5 cut(s) 183, 233, 269, 377, 395
BmiI GGNNCC 2 cut(s) 51, 159
BmrFI CCNGG 4 cut(s) 181, 267, 459, 579
BmsI GCATC 2 cut(s) 145, 397
BoxI GACNNNNGTC 1 cut(s) 274
BpuEI CTTGAG 1 cut(s) 6
BsaJI CCNNGG 5 cut(s) 14, 179, 457, 577, 578
Bsc4I CCNNNNNNNGG 2 cut(s) 374, 464
BseBI CCWGG 4 cut(s) 181, 267, 459, 579
BseDI CCNNGG 5 cut(s) 14, 179, 457, 577, 578
BseGI GGATG 3 cut(s) 154, 174, 380
BseLI CCNNNNNNNGG 2 cut(s) 374, 464
BseXI GCAGC 3 cut(s) 41, 145, 196
BsgI GTGCAG 1 cut(s) 483
BshFI GGCC 2 cut(s) 235, 396
BshNI GGYRCC 1 cut(s) 49
BslI CCNNNNNNNGG 2 cut(s) 374, 464
BsnI GGCC 2 cut(s) 235, 396
Bsp143I GATC 2 cut(s) 157, 217
BspANI GGCC 2 cut(s) 235, 396
BspLI GGNNCC 2 cut(s) 51, 159
BspMAI CTGCAG 1 cut(s) 214
BspPI GGATC 2 cut(s) 152, 165
BspT107I GGYRCC 1 cut(s) 49
BssECI CCNNGG 5 cut(s) 14, 179, 457, 577, 578
BssMI GATC 2 cut(s) 157, 217
BssT1I CCWWGG 1 cut(s) 14
Bst2UI CCWGG 4 cut(s) 181, 267, 459, 579
Bst4CI ACNGT 3 cut(s) 273, 521, 546
Bst6I CTCTTC 1 cut(s) 594
BstC8I GCNNGC 1 cut(s) 120
BstDEI CTNAG 2 cut(s) 140, 642
BstENI CCTNNNNNAGG 2 cut(s) 372, 462
BstF5I GGATG 3 cut(s) 154, 174, 380
BstKTI GATC 2 cut(s) 160, 220
BstMBI GATC 2 cut(s) 157, 217
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstNI CCWGG 4 cut(s) 181, 267, 459, 579
BstNSI RCATGY 1 cut(s) 331
BstPAI GACNNNNGTC 1 cut(s) 274
BstSCI CCNGG 4 cut(s) 179, 265, 457, 577
BstSFI CTRYAG 1 cut(s) 210
BstV1I GCAGC 3 cut(s) 41, 145, 196
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BsuRI GGCC 2 cut(s) 235, 396
BtsCI GGATG 3 cut(s) 154, 174, 380
BtsI GCAGTG 1 cut(s) 47
BtsIMutI CAGTG 2 cut(s) 47, 444
Cac8I GCNNGC 1 cut(s) 120
CaiI CAGNNNCTG 1 cut(s) 293
Cfr13I GGNCC 5 cut(s) 183, 233, 269, 377, 395
Csp6I GTAC 1 cut(s) 69
CviAII CATG 3 cut(s) 154, 191, 328
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 2 cut(s) 140, 642
DpnI GATC 2 cut(s) 159, 219
DpnII GATC 2 cut(s) 157, 217
Eam1104I CTCTTC 1 cut(s) 594
EarI CTCTTC 1 cut(s) 594
Eco130I CCWWGG 1 cut(s) 14
Eco47I GGWCC 3 cut(s) 183, 269, 377
Eco57I CTGAAG 2 cut(s) 48, 393
EcoNI CCTNNNNNAGG 2 cut(s) 372, 462
EcoO109I RGGNCCY 1 cut(s) 233
EcoRII CCWGG 4 cut(s) 179, 265, 457, 577
EcoT14I CCWWGG 1 cut(s) 14
ErhI CCWWGG 1 cut(s) 14
FaeI CATG 3 cut(s) 157, 194, 331
FatI CATG 3 cut(s) 153, 190, 327
FbaI TGATCA 1 cut(s) 217
Fnu4HI GCNGC 3 cut(s) 30, 134, 210
FokI GGATG 3 cut(s) 161, 161, 367
Fsp4HI GCNGC 3 cut(s) 30, 134, 210
GluI GCNGC 3 cut(s) 30, 134, 210
HaeIII GGCC 2 cut(s) 235, 396
Hin1II CATG 3 cut(s) 157, 194, 331
HincII GTYRAC 2 cut(s) 172, 639
HindII GTYRAC 2 cut(s) 172, 639
HinfI GANTC 3 cut(s) 19, 34, 290
HpaI GTTAAC 2 cut(s) 172, 639
HphI GGTGA 2 cut(s) 206, 350
Hpy166II GTNNAC 3 cut(s) 172, 540, 639
Hpy188I TCNGA 2 cut(s) 162, 295
Hpy8I GTNNAC 3 cut(s) 172, 540, 639
Hpy99I CGWCG 1 cut(s) 277
HpyAV CCTTC 4 cut(s) 246, 329, 368, 610
HpyCH4III ACNGT 3 cut(s) 273, 521, 546
HpyCH4V TGCA 6 cut(s) 212, 301, 313, 410, 464, 665
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
HpyF3I CTNAG 2 cut(s) 140, 642
Hsp92II CATG 3 cut(s) 157, 194, 331
Ksp22I TGATCA 1 cut(s) 217
KspAI GTTAAC 2 cut(s) 172, 639
Kzo9I GATC 2 cut(s) 157, 217
LmnI GCTCC 1 cut(s) 26
Lsp1109I GCAGC 3 cut(s) 41, 145, 196
LweI GCATC 2 cut(s) 145, 397
MaeIII GTNAC 1 cut(s) 276
MalI GATC 2 cut(s) 159, 219
MboI GATC 2 cut(s) 157, 217
MboII GAAGA 3 cut(s) 48, 353, 581
MflI RGATCY 1 cut(s) 157
MluCI AATT 3 cut(s) 259, 449, 554
MlyI GAGTC 1 cut(s) 13
MmeI TCCRAC 1 cut(s) 503
MroXI GAANNNNTTC 1 cut(s) 588
MseI TTAA 4 cut(s) 171, 258, 608, 638
MspA1I CMGCKG 1 cut(s) 209
MspR9I CCNGG 4 cut(s) 181, 267, 459, 579
MvaI CCWGG 4 cut(s) 181, 267, 459, 579
MwoI GCNNNNNNNGC 1 cut(s) 196
NdeII GATC 2 cut(s) 157, 217
NlaIII CATG 3 cut(s) 157, 194, 331
NlaIV GGNNCC 2 cut(s) 51, 159
NmuCI GTSAC 1 cut(s) 276
NspI RCATGY 1 cut(s) 331
PasI CCCWGGG 1 cut(s) 578
PdmI GAANNNNTTC 1 cut(s) 588
PfeI GAWTC 2 cut(s) 34, 290
PkrI GCNGC 3 cut(s) 31, 135, 211
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PshAI GACNNNNGTC 1 cut(s) 274
Psp6I CCWGG 4 cut(s) 179, 265, 457, 577
PspGI CCWGG 4 cut(s) 179, 265, 457, 577
PspN4I GGNNCC 2 cut(s) 51, 159
PspPI GGNCC 5 cut(s) 183, 233, 269, 377, 395
PstI CTGCAG 1 cut(s) 214
PstNI CAGNNNCTG 1 cut(s) 293
PsuI RGATCY 1 cut(s) 157
PvuII CAGCTG 1 cut(s) 209
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SaqAI TTAA 4 cut(s) 171, 258, 608, 638
SatI GCNGC 3 cut(s) 30, 134, 210
Sau3AI GATC 2 cut(s) 157, 217
Sau96I GGNCC 5 cut(s) 183, 233, 269, 377, 395
SchI GAGTC 1 cut(s) 13
ScrFI CCNGG 4 cut(s) 181, 267, 459, 579
SetI ASST 9 cut(s) 70, 95, 211, 340, 379, 429, 442, 498, 664
SfaNI GCATC 2 cut(s) 145, 397
SfcI CTRYAG 1 cut(s) 210
SinI GGWCC 3 cut(s) 183, 269, 377
SmlI CTYRAG 1 cut(s) 21
SmoI CTYRAG 1 cut(s) 21
Sse9I AATT 3 cut(s) 259, 449, 554
StyD4I CCNGG 4 cut(s) 179, 265, 457, 577
StyI CCWWGG 1 cut(s) 14
TaaI ACNGT 3 cut(s) 273, 521, 546
TaqI TCGA 1 cut(s) 480
TaqII GACCGA 1 cut(s) 200
TasI AATT 3 cut(s) 259, 449, 554
TfiI GAWTC 2 cut(s) 34, 290
Tru1I TTAA 4 cut(s) 171, 258, 608, 638
Tru9I TTAA 4 cut(s) 171, 258, 608, 638
TscAI CASTG 2 cut(s) 47, 451
TseFI GTSAC 1 cut(s) 276
TseI GCWGC 3 cut(s) 29, 133, 209
Tsp45I GTSAC 1 cut(s) 276
TspDTI ATGAA 3 cut(s) 228, 348, 610
TspGWI ACGGA 1 cut(s) 72
TspRI CASTG 2 cut(s) 47, 451
VpaK11BI GGWCC 3 cut(s) 183, 269, 377
XagI CCTNNNNNAGG 2 cut(s) 372, 462
XceI RCATGY 1 cut(s) 331
XmnI GAANNNNTTC 1 cut(s) 588
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.