FvH4_1g07490

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
3984634 .. 3984852
219 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g07490.t1

Sequence Viewer

Length: 219 bp
ATGGATAAGGGACACATTCCAATTCCTACTAAGAAACTCCTGGCAATTTGCTATAAGACTGTAGAGAGGATGAAGGTGATCAATAGCAGAAAGAACCAATTTGACTGCAACAAGAGAATCTACTTCAACTTCCAAAGAGTTGCAACCATGCTGCTATGCCATCTCCATTCCTTTCAAAAGTCCCCAAAGTTCAGCTTCAAGAACTTGTCCAATACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.55

Weight (kDa)

10.17

Isoelectric Point (pI)

25.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 127, 176, 199
AjnI CCWGG 1 cut(s) 39
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
ApeKI GCWGC 1 cut(s) 151
AsuHPI GGTGA 1 cut(s) 88
BbvI GCAGC 1 cut(s) 138
BccI CCATC 1 cut(s) 168
BciT130I CCWGG 1 cut(s) 41
BclI TGATCA 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 60
BisI GCNGC 1 cut(s) 152
BlsI GCNGC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 41
BseGI GGATG 1 cut(s) 75
BseXI GCAGC 1 cut(s) 138
BslFI GGGAC 2 cut(s) 24, 166
BsmFI GGGAC 2 cut(s) 24, 166
Bsp143I GATC 1 cut(s) 78
BssMI GATC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 41
Bst4CI ACNGT 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 75
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 41
BstSCI CCNGG 1 cut(s) 39
BstSFI CTRYAG 1 cut(s) 60
BstV1I GCAGC 1 cut(s) 138
BtsCI GGATG 1 cut(s) 75
CviAII CATG 1 cut(s) 148
CviJI RGCY 1 cut(s) 195
CviKI_1 RGCY 1 cut(s) 195
DdeI CTNAG 1 cut(s) 30
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 39
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 54, 149, 157
FalI AAGNNNNNCTT 2 cut(s) 179, 211
FaqI GGGAC 2 cut(s) 24, 166
FatI CATG 1 cut(s) 147
FbaI TGATCA 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 152
FokI GGATG 1 cut(s) 82
Fsp4HI GCNGC 1 cut(s) 152
GluI GCNGC 1 cut(s) 152
Hin1II CATG 1 cut(s) 151
HinfI GANTC 1 cut(s) 117
HphI GGTGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4V TGCA 2 cut(s) 108, 143
HpyF3I CTNAG 1 cut(s) 30
Hsp92II CATG 1 cut(s) 151
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 2 cut(s) 26, 53
Lsp1109I GCAGC 1 cut(s) 138
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MluCI AATT 3 cut(s) 21, 45, 98
MnlI CCTC 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 41
MvaI CCWGG 1 cut(s) 41
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 151
PfeI GAWTC 1 cut(s) 117
PkrI GCNGC 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
SatI GCNGC 1 cut(s) 152
Sau3AI GATC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 41
SetI ASST 3 cut(s) 78, 197, 218
SfcI CTRYAG 1 cut(s) 60
SgeI CNNG 5 cut(s) 52, 53, 124, 160, 211
Sse9I AATT 3 cut(s) 21, 45, 98
StyD4I CCNGG 1 cut(s) 39
TaaI ACNGT 1 cut(s) 61
TasI AATT 3 cut(s) 21, 45, 98
TfiI GAWTC 1 cut(s) 117
TseI GCWGC 1 cut(s) 151
TspDTI ATGAA 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.