FvH4_6g04610

RIBOSOMAL protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0005111
Physical Location & Seq
Forward (+)
2535630 .. 2536718
1089 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g04610.t2

Sequence Viewer

Length: 228 bp
ATGGTGTCTACCAAAGGCATTAGACTGAGGTTTCAAGGAGAAGACATGAATGCGTTCAAGGCTTTTAAAACCAATGTTCCAATTGCATGGAGCCCTAATCTGTATATAACTCTGGTGAGTGGAATCCCAGGAACCAGGAGGCTTCACAGGCGCACTTTAGAGGCACTATGTCTTCGCAAATGCAACCGAACTGTCATGCCATGGAACACTCCTACTGTTAGGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L30

Protein Analysis

76

Amino Acids

8.66

Weight (kDa)

11.22

Isoelectric Point (pI)

37.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L30 PF00327 35 - 76 2.5e-10 Ribosomal protein L30p/L7e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 8
AgsI TTSAA 2 cut(s) 35, 58
AjnI CCWGG 2 cut(s) 127, 134
Asp700I GAANNNNTTC 1 cut(s) 53
AspLEI GCGC 1 cut(s) 153
AsuHPI GGTGA 1 cut(s) 127
BanII GRGCYC 1 cut(s) 95
BbsI GAAGAC 2 cut(s) 48, 164
BciT130I CCWGG 2 cut(s) 129, 136
Bme1390I CCNGG 2 cut(s) 129, 136
BmiI GGNNCC 2 cut(s) 92, 133
BmrFI CCNGG 2 cut(s) 129, 136
BpiI GAAGAC 2 cut(s) 48, 164
BsaJI CCNNGG 2 cut(s) 127, 200
BseBI CCWGG 2 cut(s) 129, 136
BseDI CCNNGG 2 cut(s) 127, 200
BseMII CTCAG 1 cut(s) 17
BsmI GAATGC 1 cut(s) 55
Bsp1286I GDGCHC 1 cut(s) 95
Bsp19I CCATGG 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 18
BspLI GGNNCC 2 cut(s) 92, 133
BssECI CCNNGG 2 cut(s) 127, 200
BssT1I CCWWGG 1 cut(s) 200
Bst2UI CCWGG 2 cut(s) 129, 136
Bst4CI ACNGT 2 cut(s) 193, 217
BstDEI CTNAG 1 cut(s) 26
BstDSI CCRYGG 1 cut(s) 200
BstHHI GCGC 1 cut(s) 153
BstMWI GCNNNNNNNGC 2 cut(s) 59, 148
BstNI CCWGG 2 cut(s) 129, 136
BstSCI CCNGG 2 cut(s) 127, 134
BstV2I GAAGAC 2 cut(s) 48, 164
BstXI CCANNNNNNTGG 1 cut(s) 87
BtgI CCRYGG 1 cut(s) 200
CfoI GCGC 1 cut(s) 153
CviAII CATG 4 cut(s) 46, 87, 196, 201
CviJI RGCY 3 cut(s) 62, 93, 142
CviKI_1 RGCY 3 cut(s) 62, 93, 142
DdeI CTNAG 1 cut(s) 26
DraI TTTAAA 1 cut(s) 67
Eco130I CCWWGG 1 cut(s) 200
Eco24I GRGCYC 1 cut(s) 95
EcoRII CCWGG 2 cut(s) 127, 134
EcoT14I CCWWGG 1 cut(s) 200
EcoT38I GRGCYC 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 200
FaeI CATG 4 cut(s) 49, 90, 199, 204
FaiI YATR 7 cut(s) 47, 88, 105, 107, 169, 197, 202
FatI CATG 4 cut(s) 45, 86, 195, 200
FblI GTMKAC 1 cut(s) 8
FriOI GRGCYC 1 cut(s) 95
GlaI GCGC 1 cut(s) 152
HhaI GCGC 1 cut(s) 153
Hin1II CATG 4 cut(s) 49, 90, 199, 204
Hin6I GCGC 1 cut(s) 151
HinP1I GCGC 1 cut(s) 151
HinfI GANTC 1 cut(s) 123
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 9
Hpy8I GTNNAC 1 cut(s) 9
HpyCH4III ACNGT 2 cut(s) 193, 217
HpyCH4V TGCA 2 cut(s) 86, 183
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 148
HpyF3I CTNAG 1 cut(s) 26
Hsp92II CATG 4 cut(s) 49, 90, 199, 204
HspAI GCGC 1 cut(s) 151
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 6 cut(s) 98, 114, 121, 133, 141, 148
MboII GAAGA 2 cut(s) 53, 164
MfeI CAATTG 1 cut(s) 81
MhlI GDGCHC 1 cut(s) 95
MluCI AATT 1 cut(s) 81
MnlI CCTC 3 cut(s) 21, 132, 154
MroXI GAANNNNTTC 1 cut(s) 53
MseI TTAA 1 cut(s) 66
MspR9I CCNGG 2 cut(s) 129, 136
MunI CAATTG 1 cut(s) 81
Mva1269I GAATGC 1 cut(s) 55
MvaI CCWGG 2 cut(s) 129, 136
MwoI GCNNNNNNNGC 2 cut(s) 59, 148
NcoI CCATGG 1 cut(s) 200
NlaIII CATG 4 cut(s) 49, 90, 199, 204
NlaIV GGNNCC 2 cut(s) 92, 133
PctI GAATGC 1 cut(s) 55
PdmI GAANNNNTTC 1 cut(s) 53
PfeI GAWTC 1 cut(s) 123
Psp6I CCWGG 2 cut(s) 127, 134
PspGI CCWGG 2 cut(s) 127, 134
PspN4I GGNNCC 2 cut(s) 92, 133
SaqAI TTAA 1 cut(s) 66
ScrFI CCNGG 2 cut(s) 129, 136
SduI GDGCHC 1 cut(s) 95
SetI ASST 1 cut(s) 32
Sse9I AATT 1 cut(s) 81
StyD4I CCNGG 2 cut(s) 127, 134
StyI CCWWGG 1 cut(s) 200
TaaI ACNGT 2 cut(s) 193, 217
TasI AATT 1 cut(s) 81
TfiI GAWTC 1 cut(s) 123
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TspDTI ATGAA 1 cut(s) 62
XmiI GTMKAC 1 cut(s) 8
XmnI GAANNNNTTC 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.