MD09G1112900.v1.1

RIBOSOMAL protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
8572057 .. 8573624
1568 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1112900.v1.1.491

Sequence Viewer

Length: 174 bp
ATGCGATGGAATACTCCTACAGTCAGGGGAATGCTCCAACAGGTTAAGAGATTGGTCGTGATTGAGACAGAAGAGATGTATAAAGCCCGCAAACAAAACTTGGAAAGCCACCGAGCTCTGCGCCCCCCTTTGGTCATAAATCACCAACCTGCTTCTGCAAGTGGTTCTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.54

Weight (kDa)

10.9

Isoelectric Point (pI)

79.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 157
AciI CCGC 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 130
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
Alw21I GWGCWC 1 cut(s) 118
Alw26I GTCTC 1 cut(s) 59
AspLEI GCGC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 134
BanII GRGCYC 1 cut(s) 118
Bbv12I GWGCWC 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 59
BfmI CTRYAG 1 cut(s) 18
BfuAI ACCTGC 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 130
BsiHKAI GWGCWC 1 cut(s) 118
BslI CCNNNNNNNGG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 59
BsmI GAATGC 1 cut(s) 36
Bsp1286I GDGCHC 1 cut(s) 118
BspACI CCGC 1 cut(s) 88
BspMI ACCTGC 1 cut(s) 157
Bst4CI ACNGT 1 cut(s) 22
Bst6I CTCTTC 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 88
BstHHI GCGC 1 cut(s) 123
BstMAI GTCTC 1 cut(s) 59
BstSFI CTRYAG 1 cut(s) 18
BtgZI GCGATG 1 cut(s) 19
BveI ACCTGC 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 88
CfoI GCGC 1 cut(s) 123
CviJI RGCY 3 cut(s) 86, 108, 116
CviKI_1 RGCY 3 cut(s) 86, 108, 116
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
Ecl136II GAGCTC 1 cut(s) 116
Eco24I GRGCYC 1 cut(s) 118
Eco53kI GAGCTC 1 cut(s) 116
EcoICRI GAGCTC 1 cut(s) 116
EcoT38I GRGCYC 1 cut(s) 118
FaiI YATR 2 cut(s) 81, 137
FalI AAGNNNNNCTT 1 cut(s) 151
FauI CCCGC 1 cut(s) 95
FriOI GRGCYC 1 cut(s) 118
GlaI GCGC 1 cut(s) 122
HhaI GCGC 1 cut(s) 123
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HphI GGTGA 1 cut(s) 134
Hpy188III TCNNGA 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 158
HspAI GCGC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 3 cut(s) 10, 26, 162
MboII GAAGA 2 cut(s) 83, 159
MhlI GDGCHC 1 cut(s) 118
MmeI TCCRAC 1 cut(s) 61
MseI TTAA 2 cut(s) 45, 172
Mva1269I GAATGC 1 cut(s) 36
PctI GAATGC 1 cut(s) 36
Psp124BI GAGCTC 1 cut(s) 118
SacI GAGCTC 1 cut(s) 118
SaqAI TTAA 2 cut(s) 45, 172
SduI GDGCHC 1 cut(s) 118
SetI ASST 3 cut(s) 45, 118, 151
SfcI CTRYAG 1 cut(s) 18
SgeI CNNG 7 cut(s) 37, 53, 70, 99, 112, 125, 161
SsiI CCGC 1 cut(s) 88
SstI GAGCTC 1 cut(s) 118
TaaI ACNGT 1 cut(s) 22
Tru1I TTAA 2 cut(s) 45, 172
Tru9I TTAA 2 cut(s) 45, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.