Prupe.3G211700_v2.0.a1

RIBOSOMAL protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0005111
Physical Location & Seq
Reverse (-)
21645865 .. 21647655
1791 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G211700.3

Sequence Viewer

Length: 324 bp
ATGAATGCTTTCAAGGCTTTTAAAGCTAGTGTCCCAATTGCATGGAGCCCTAATCTATATATAACTTTGGTAAGGGGAATCCCAGGAACCAGGAGACTTCACAGGCGTACTTTAGAGGCATTACGTCTCCGCAAGTGCAACCGAACTGTTATGCGATGGAACACTCCTACAGTTAGGGGAATGCTCCAACAGGTTAAGAGATTGGTCGTGATTGAGACAGAAGAGATGTATAAGGCCCGCAAACAAAATTTGGAAAACCACCGAGCTCTACGTCCCCCTTTGGTCATAAATCACCTACCTGCTTCTGCAAGTGGTTCTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L30

Protein Analysis

108

Amino Acids

12.33

Weight (kDa)

11.76

Isoelectric Point (pI)

59.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 307
AciI CCGC 2 cut(s) 130, 238
AcsI RAATTY 1 cut(s) 247
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 1 cut(s) 13
AjnI CCWGG 2 cut(s) 82, 89
AluBI AGCT 2 cut(s) 26, 266
AluI AGCT 2 cut(s) 26, 266
Alw21I GWGCWC 1 cut(s) 268
Alw26I GTCTC 3 cut(s) 88, 131, 209
AoxI GGCC 1 cut(s) 234
ApoI RAATTY 1 cut(s) 247
Asp700I GAANNNNTTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 1 cut(s) 284
BanII GRGCYC 2 cut(s) 50, 268
Bbv12I GWGCWC 1 cut(s) 268
BccI CCATC 1 cut(s) 150
BciT130I CCWGG 2 cut(s) 84, 91
BcoDI GTCTC 3 cut(s) 88, 131, 209
BfaI CTAG 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 168
BfuAI ACCTGC 1 cut(s) 307
Bme1390I CCNGG 2 cut(s) 84, 91
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 2 cut(s) 47, 88
BmrFI CCNGG 2 cut(s) 84, 91
BsaJI CCNNGG 1 cut(s) 82
BseBI CCWGG 2 cut(s) 84, 91
BseDI CCNNGG 1 cut(s) 82
BshFI GGCC 1 cut(s) 236
BsiHKAI GWGCWC 1 cut(s) 268
BslFI GGGAC 2 cut(s) 17, 258
BsmAI GTCTC 3 cut(s) 88, 131, 209
BsmBI CGTCTC 1 cut(s) 131
BsmFI GGGAC 2 cut(s) 17, 258
BsmI GAATGC 2 cut(s) 10, 186
BsnI GGCC 1 cut(s) 236
Bsp1286I GDGCHC 2 cut(s) 50, 268
BspACI CCGC 2 cut(s) 130, 238
BspANI GGCC 1 cut(s) 236
BspLI GGNNCC 2 cut(s) 47, 88
BspMI ACCTGC 1 cut(s) 307
BssECI CCNNGG 1 cut(s) 82
Bst2UI CCWGG 2 cut(s) 84, 91
Bst4CI ACNGT 2 cut(s) 148, 172
Bst6I CTCTTC 1 cut(s) 216
BstC8I GCNNGC 1 cut(s) 238
BstMAI GTCTC 3 cut(s) 88, 131, 209
BstMWI GCNNNNNNNGC 2 cut(s) 14, 23
BstNI CCWGG 2 cut(s) 84, 91
BstSCI CCNGG 2 cut(s) 82, 89
BstSFI CTRYAG 1 cut(s) 168
BstXI CCANNNNNNTGG 1 cut(s) 42
BsuRI GGCC 1 cut(s) 236
BtgZI GCGATG 1 cut(s) 169
BveI ACCTGC 1 cut(s) 307
Cac8I GCNNGC 1 cut(s) 238
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 1 cut(s) 108
CviAII CATG 1 cut(s) 42
CviJI RGCY 5 cut(s) 17, 26, 48, 236, 266
CviKI_1 RGCY 5 cut(s) 17, 26, 48, 236, 266
CviQI GTAC 1 cut(s) 108
DraI TTTAAA 1 cut(s) 22
Eam1104I CTCTTC 1 cut(s) 216
EarI CTCTTC 1 cut(s) 216
Ecl136II GAGCTC 1 cut(s) 266
Eco24I GRGCYC 2 cut(s) 50, 268
Eco53kI GAGCTC 1 cut(s) 266
EcoICRI GAGCTC 1 cut(s) 266
EcoRII CCWGG 2 cut(s) 82, 89
EcoT38I GRGCYC 2 cut(s) 50, 268
Esp3I CGTCTC 1 cut(s) 131
FaeI CATG 1 cut(s) 45
FaiI YATR 7 cut(s) 43, 58, 60, 62, 152, 231, 287
FalI AAGNNNNNCTT 1 cut(s) 301
FaqI GGGAC 2 cut(s) 17, 258
FatI CATG 1 cut(s) 41
FauI CCCGC 1 cut(s) 245
FriOI GRGCYC 2 cut(s) 50, 268
FspBI CTAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 236
Hin1II CATG 1 cut(s) 45
HinfI GANTC 1 cut(s) 78
HphI GGTGA 1 cut(s) 284
Hpy188III TCNNGA 1 cut(s) 208
HpyCH4III ACNGT 2 cut(s) 148, 172
HpyCH4IV ACGT 2 cut(s) 124, 271
HpyCH4V TGCA 3 cut(s) 41, 138, 308
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 23
HpySE526I ACGT 2 cut(s) 124, 271
Hsp92II CATG 1 cut(s) 45
LmnI GCTCC 2 cut(s) 45, 189
LpnPI CCDG 7 cut(s) 69, 76, 88, 96, 103, 176, 312
MaeI CTAG 1 cut(s) 27
MaeII ACGT 2 cut(s) 124, 271
MboII GAAGA 2 cut(s) 233, 309
MfeI CAATTG 1 cut(s) 36
MhlI GDGCHC 2 cut(s) 50, 268
MluCI AATT 2 cut(s) 36, 247
MmeI TCCRAC 1 cut(s) 211
MnlI CCTC 1 cut(s) 109
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 3 cut(s) 21, 195, 322
MspR9I CCNGG 2 cut(s) 84, 91
MunI CAATTG 1 cut(s) 36
Mva1269I GAATGC 2 cut(s) 10, 186
MvaI CCWGG 2 cut(s) 84, 91
MwoI GCNNNNNNNGC 2 cut(s) 14, 23
NlaIII CATG 1 cut(s) 45
NlaIV GGNNCC 2 cut(s) 47, 88
PctI GAATGC 2 cut(s) 10, 186
PdmI GAANNNNTTC 1 cut(s) 8
PfeI GAWTC 1 cut(s) 78
Psp124BI GAGCTC 1 cut(s) 268
Psp6I CCWGG 2 cut(s) 82, 89
PspGI CCWGG 2 cut(s) 82, 89
PspN4I GGNNCC 2 cut(s) 47, 88
PspPI GGNCC 1 cut(s) 235
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
SacI GAGCTC 1 cut(s) 268
SaqAI TTAA 3 cut(s) 21, 195, 322
Sau96I GGNCC 1 cut(s) 235
ScrFI CCNGG 2 cut(s) 84, 91
SduI GDGCHC 2 cut(s) 50, 268
SetI ASST 7 cut(s) 28, 127, 195, 268, 274, 297, 301
SfcI CTRYAG 1 cut(s) 168
Sse9I AATT 2 cut(s) 36, 247
SsiI CCGC 2 cut(s) 130, 238
SspMI CTAG 1 cut(s) 27
SstI GAGCTC 1 cut(s) 268
StyD4I CCNGG 2 cut(s) 82, 89
TaaI ACNGT 2 cut(s) 148, 172
TaiI ACGT 2 cut(s) 127, 274
TasI AATT 2 cut(s) 36, 247
TfiI GAWTC 1 cut(s) 78
Tru1I TTAA 3 cut(s) 21, 195, 322
Tru9I TTAA 3 cut(s) 21, 195, 322
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 247
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.