FvH4_6g36140

GPN-loop GTPase

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
28419022 .. 28424467
5446 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g36140.t1

Sequence Viewer

Length: 195 bp
ATGGCTCCTCAGTTTGCAAAGCTCAACAAGGCTTTGATGGAACTGGGTGATGATTATAGCATGGTGAGTTTTGTGCCACTTGACTTGAGGAAGGAAAGCAGCATAAGATATGTATTGGCTCAAATTGATAACTCGATTCACTTCGGAGAAGATGCCGATCTAAAGGTTAAGGACTTTGATCCAGAAGCTCCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.23

Weight (kDa)

4.51

Isoelectric Point (pI)

34.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 173
AluBI AGCT 2 cut(s) 22, 188
AluI AGCT 2 cut(s) 22, 188
AlwI GGATC 1 cut(s) 173
ApeKI GCWGC 1 cut(s) 99
AsuHPI GGTGA 2 cut(s) 59, 76
BbvI GCAGC 1 cut(s) 111
BccI CCATC 1 cut(s) 31
BisI GCNGC 1 cut(s) 100
BlsI GCNGC 1 cut(s) 101
BmiI GGNNCC 1 cut(s) 6
BmrI ACTGGG 1 cut(s) 53
BmsI GCATC 1 cut(s) 142
BmuI ACTGGG 1 cut(s) 53
BpuEI CTTGAG 1 cut(s) 106
BsaBI GATNNNNATC 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 48
Bse8I GATNNNNATC 1 cut(s) 156
BseJI GATNNNNATC 1 cut(s) 156
BseMII CTCAG 1 cut(s) 23
BseNI ACTGG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 111
Bsp143I GATC 2 cut(s) 157, 178
BspCNI CTCAG 1 cut(s) 22
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 48
BssMI GATC 2 cut(s) 157, 178
BstDEI CTNAG 1 cut(s) 9
BstKTI GATC 2 cut(s) 160, 181
BstMBI GATC 2 cut(s) 157, 178
BstV1I GCAGC 1 cut(s) 111
CspCI CAANNNNNGTGG 2 cut(s) 66, 101
CviAII CATG 1 cut(s) 61
CviJI RGCY 5 cut(s) 5, 22, 32, 119, 188
CviKI_1 RGCY 5 cut(s) 5, 22, 32, 119, 188
DdeI CTNAG 1 cut(s) 9
DpnI GATC 2 cut(s) 159, 180
DpnII GATC 2 cut(s) 157, 178
FaeI CATG 1 cut(s) 64
FaiI YATR 4 cut(s) 57, 62, 104, 111
FatI CATG 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 100
GluI GCNGC 1 cut(s) 100
Hin1II CATG 1 cut(s) 64
HinfI GANTC 1 cut(s) 136
HphI GGTGA 2 cut(s) 59, 76
Hpy188I TCNGA 1 cut(s) 146
Hpy188III TCNNGA 1 cut(s) 182
HpyAV CCTTC 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 9
Hsp92II CATG 1 cut(s) 64
Kzo9I GATC 2 cut(s) 157, 178
LmnI GCTCC 2 cut(s) 10, 193
LpnPI CCDG 1 cut(s) 29
Lsp1109I GCAGC 1 cut(s) 111
LweI GCATC 1 cut(s) 142
MalI GATC 2 cut(s) 159, 180
MboI GATC 2 cut(s) 157, 178
MboII GAAGA 1 cut(s) 161
MluCI AATT 1 cut(s) 123
MnlI CCTC 2 cut(s) 18, 81
MseI TTAA 1 cut(s) 168
NdeII GATC 2 cut(s) 157, 178
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 136
PkrI GCNGC 1 cut(s) 101
PspN4I GGNNCC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 1 cut(s) 100
Sau3AI GATC 2 cut(s) 157, 178
SetI ASST 3 cut(s) 24, 168, 190
SfaNI GCATC 1 cut(s) 142
SgeI CNNG 6 cut(s) 40, 56, 73, 92, 97, 145
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
Sse9I AATT 1 cut(s) 123
TaqI TCGA 1 cut(s) 134
TasI AATT 1 cut(s) 123
TfiI GAWTC 1 cut(s) 136
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 1 cut(s) 99
TspGWI ACGGA 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.