MD09G1159000.v1.1

GPN-loop GTPase 3 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0002226
Physical Location & Seq
Forward (+)
12707744 .. 12709480
1737 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1159000.v1.1.491

Sequence Viewer

Length: 591 bp
ATGTCCTTAATCTTGATTTCTGGACACCTGGAAGAAAATCTGGATGAATGGCTCACAGAGGAATTGGACAATTACACGGATGATGACTACTTAGTTTTTGACTGCCCAGGCCAGATAGAACTTTTCTCGCATGTGCCTGTGCTTCGGAACTTTGTGGAGCATCTGCAGCGTAAAAATTTCAAAGTCTGTGTTGTCTACTTGCTTGATTCTCAGTTCATTACGGATGTGACTAAGTTTATTAGTGGGTGCATGGCATCTCTTTCTGCCATGATTCAACTTGAATTACCACATGTTAATATCCTCTCCAAAATGGACCTTGCACCGAGAAAAAAGGATATTGAAGACTTCTTGTATCCGGAGCCTCAAGTTTTATTATCAGAGTTGAATCAACGCATGGCTCCTCAGTTTGCAAAGCTAAATAAATCTTTGATTGAACTGGTCGATGATTATAGCATGGTGAGTTTTCTGCCACTAGACTTGAGGAAGTCAAGCAGCATGAGCTACGTCCTGGCTCAGATCGATACCTGCATTCAGTTCGGAGAAGATGCCGATGTGAAGGTTAAGGAATTTGATCAGGAAGAAGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ATP_bind_1

Protein Analysis

197

Amino Acids

22.62

Weight (kDa)

4.36

Isoelectric Point (pI)

51.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP_bind_1 PF03029 10 - 178 8.6e-46 Conserved hypothetical ATP binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 533
AccI GTMKAC 1 cut(s) 195
AccIII TCCGGA 1 cut(s) 355
AcsI RAATTY 2 cut(s) 175, 566
AflIII ACRYGT 1 cut(s) 289
AgsI TTSAA 6 cut(s) 181, 275, 281, 341, 385, 434
AjnI CCWGG 3 cut(s) 27, 106, 507
AluBI AGCT 2 cut(s) 415, 501
AluI AGCT 2 cut(s) 415, 501
Aor13HI TCCGGA 1 cut(s) 355
AoxI GGCC 1 cut(s) 109
ApeKI GCWGC 2 cut(s) 166, 492
ApoI RAATTY 2 cut(s) 175, 566
AspS9I GGNCC 1 cut(s) 313
AsuHPI GGTGA 1 cut(s) 469
AvaII GGWCC 1 cut(s) 313
BbsI GAAGAC 1 cut(s) 348
BbvI GCAGC 2 cut(s) 178, 504
BcgI CGANNNNNNTGC 2 cut(s) 517, 551
BciT130I CCWGG 3 cut(s) 29, 108, 509
BciVI GTATCC 1 cut(s) 363
BclI TGATCA 1 cut(s) 571
BfaI CTAG 1 cut(s) 473
BfmI CTRYAG 1 cut(s) 164
BfuAI ACCTGC 1 cut(s) 533
BfuI GTATCC 1 cut(s) 363
BisI GCNGC 2 cut(s) 167, 493
BlsI GCNGC 2 cut(s) 168, 494
Bme1390I CCNGG 3 cut(s) 29, 108, 509
Bme18I GGWCC 1 cut(s) 313
BmgT120I GGNCC 1 cut(s) 313
BmiI GGNNCC 2 cut(s) 360, 399
BmrFI CCNGG 3 cut(s) 29, 108, 509
BmsI GCATC 3 cut(s) 169, 263, 535
BpiI GAAGAC 1 cut(s) 348
BpuEI CTTGAG 2 cut(s) 348, 499
Bsa29I ATCGAT 1 cut(s) 519
BsaJI CCNNGG 1 cut(s) 106
BsaWI WCCGGW 1 cut(s) 355
Bse1I ACTGG 1 cut(s) 441
BseAI TCCGGA 1 cut(s) 355
BseBI CCWGG 3 cut(s) 29, 108, 509
BseCI ATCGAT 1 cut(s) 519
BseDI CCNNGG 1 cut(s) 106
BseGI GGATG 3 cut(s) 49, 85, 229
BseMII CTCAG 3 cut(s) 224, 416, 527
BseNI ACTGG 1 cut(s) 441
BseRI GAGGAG 1 cut(s) 390
BseXI GCAGC 2 cut(s) 178, 504
BshFI GGCC 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 519
BsiSI CCGG 1 cut(s) 356
BsmI GAATGC 1 cut(s) 528
BsnI GGCC 1 cut(s) 111
Bsp13I TCCGGA 1 cut(s) 355
Bsp143I GATC 2 cut(s) 516, 571
BspANI GGCC 1 cut(s) 111
BspCNI CTCAG 3 cut(s) 223, 415, 526
BspDI ATCGAT 1 cut(s) 519
BspEI TCCGGA 1 cut(s) 355
BspLI GGNNCC 2 cut(s) 360, 399
BspMAI CTGCAG 1 cut(s) 168
BspMI ACCTGC 1 cut(s) 533
BsrI ACTGG 1 cut(s) 441
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 2 cut(s) 516, 571
Bst2UI CCWGG 3 cut(s) 29, 108, 509
BstDEI CTNAG 5 cut(s) 91, 210, 231, 402, 513
BstF5I GGATG 3 cut(s) 49, 85, 229
BstKTI GATC 2 cut(s) 519, 574
BstMBI GATC 2 cut(s) 516, 571
BstMWI GCNNNNNNNGC 2 cut(s) 166, 498
BstNI CCWGG 3 cut(s) 29, 108, 509
BstNSI RCATGY 2 cut(s) 134, 293
BstSCI CCNGG 3 cut(s) 27, 106, 507
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 2 cut(s) 178, 504
BstV2I GAAGAC 1 cut(s) 348
Bsu15I ATCGAT 1 cut(s) 519
BsuI GTATCC 1 cut(s) 363
BsuRI GGCC 1 cut(s) 111
BsuTUI ATCGAT 1 cut(s) 519
BtsCI GGATG 3 cut(s) 49, 85, 229
BveI ACCTGC 1 cut(s) 533
Cfr13I GGNCC 1 cut(s) 313
ClaI ATCGAT 1 cut(s) 519
CspCI CAANNNNNGTGG 2 cut(s) 459, 494
CviAII CATG 7 cut(s) 131, 250, 268, 290, 394, 454, 496
CviJI RGCY 7 cut(s) 52, 111, 361, 398, 415, 501, 512
CviKI_1 RGCY 7 cut(s) 52, 111, 361, 398, 415, 501, 512
DdeI CTNAG 5 cut(s) 91, 210, 231, 402, 513
DpnI GATC 2 cut(s) 518, 573
DpnII GATC 2 cut(s) 516, 571
Eco47I GGWCC 1 cut(s) 313
EcoRII CCWGG 3 cut(s) 27, 106, 507
FaeI CATG 7 cut(s) 134, 253, 271, 293, 397, 457, 499
FaiI YATR 8 cut(s) 132, 251, 269, 291, 395, 450, 455, 497
FatI CATG 7 cut(s) 130, 249, 267, 289, 393, 453, 495
FbaI TGATCA 1 cut(s) 571
FblI GTMKAC 1 cut(s) 195
Fnu4HI GCNGC 2 cut(s) 167, 493
FokI GGATG 3 cut(s) 56, 92, 236
Fsp4HI GCNGC 2 cut(s) 167, 493
FspBI CTAG 1 cut(s) 473
GluI GCNGC 2 cut(s) 167, 493
HaeIII GGCC 1 cut(s) 111
HapII CCGG 1 cut(s) 356
Hin1II CATG 7 cut(s) 134, 253, 271, 293, 397, 457, 499
HinfI GANTC 3 cut(s) 206, 271, 385
HpaII CCGG 1 cut(s) 356
HphI GGTGA 1 cut(s) 469
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 4 cut(s) 147, 379, 516, 539
Hpy188III TCNNGA 5 cut(s) 13, 21, 41, 356, 575
Hpy8I GTNNAC 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 550
HpyCH4IV ACGT 1 cut(s) 504
HpyCH4V TGCA 5 cut(s) 166, 249, 320, 410, 528
HpyF10VI GCNNNNNNNGC 2 cut(s) 166, 498
HpyF3I CTNAG 5 cut(s) 91, 210, 231, 402, 513
HpySE526I ACGT 1 cut(s) 504
Hsp92II CATG 7 cut(s) 134, 253, 271, 293, 397, 457, 499
Kpn2I TCCGGA 1 cut(s) 355
Ksp22I TGATCA 1 cut(s) 571
Kzo9I GATC 2 cut(s) 516, 571
LmnI GCTCC 3 cut(s) 157, 358, 403
Lsp1109I GCAGC 2 cut(s) 178, 504
LweI GCATC 3 cut(s) 169, 263, 535
MaeI CTAG 1 cut(s) 473
MaeII ACGT 1 cut(s) 504
MaeIII GTNAC 1 cut(s) 226
MalI GATC 2 cut(s) 518, 573
MboI GATC 2 cut(s) 516, 571
MboII GAAGA 4 cut(s) 44, 353, 554, 590
MluCI AATT 5 cut(s) 62, 70, 175, 281, 566
MnlI CCTC 5 cut(s) 52, 311, 372, 411, 474
MroI TCCGGA 1 cut(s) 355
MseI TTAA 3 cut(s) 8, 294, 561
MspI CCGG 1 cut(s) 356
MspR9I CCNGG 3 cut(s) 29, 108, 509
Mva1269I GAATGC 1 cut(s) 528
MvaI CCWGG 3 cut(s) 29, 108, 509
MwoI GCNNNNNNNGC 2 cut(s) 166, 498
NdeII GATC 2 cut(s) 516, 571
NlaIII CATG 7 cut(s) 134, 253, 271, 293, 397, 457, 499
NlaIV GGNNCC 2 cut(s) 360, 399
NmuCI GTSAC 1 cut(s) 226
NspI RCATGY 2 cut(s) 134, 293
PciI ACATGT 1 cut(s) 289
PctI GAATGC 1 cut(s) 528
PfeI GAWTC 3 cut(s) 206, 271, 385
PkrI GCNGC 2 cut(s) 168, 494
PscI ACATGT 1 cut(s) 289
Psp6I CCWGG 3 cut(s) 27, 106, 507
PspGI CCWGG 3 cut(s) 27, 106, 507
PspN4I GGNNCC 2 cut(s) 360, 399
PspPI GGNCC 1 cut(s) 313
PstI CTGCAG 1 cut(s) 168
SaqAI TTAA 3 cut(s) 8, 294, 561
SatI GCNGC 2 cut(s) 167, 493
Sau3AI GATC 2 cut(s) 516, 571
Sau96I GGNCC 1 cut(s) 313
ScrFI CCNGG 3 cut(s) 29, 108, 509
SetI ASST 7 cut(s) 30, 318, 417, 503, 507, 527, 561
SfaNI GCATC 3 cut(s) 169, 263, 535
SfcI CTRYAG 1 cut(s) 164
SinI GGWCC 1 cut(s) 313
SmlI CTYRAG 2 cut(s) 363, 478
SmoI CTYRAG 2 cut(s) 363, 478
Sse9I AATT 5 cut(s) 62, 70, 175, 281, 566
SspMI CTAG 1 cut(s) 473
StyD4I CCNGG 3 cut(s) 27, 106, 507
TaiI ACGT 1 cut(s) 507
TaqI TCGA 2 cut(s) 441, 519
TasI AATT 5 cut(s) 62, 70, 175, 281, 566
TfiI GAWTC 3 cut(s) 206, 271, 385
Tru1I TTAA 3 cut(s) 8, 294, 561
Tru9I TTAA 3 cut(s) 8, 294, 561
TseFI GTSAC 1 cut(s) 226
TseI GCWGC 2 cut(s) 166, 492
Tsp45I GTSAC 1 cut(s) 226
TspDTI ATGAA 2 cut(s) 60, 205
TspGWI ACGGA 2 cut(s) 92, 236
VpaK11BI GGWCC 1 cut(s) 313
XapI RAATTY 2 cut(s) 175, 566
XceI RCATGY 2 cut(s) 134, 293
XmiI GTMKAC 1 cut(s) 195
XspI CTAG 1 cut(s) 473
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.