Rmu_sc0001169.1_g000004

GPN-loop GTPase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001169.1
Physical Location & Seq
Forward (+)
34092 .. 37546
3455 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001169.1_g000004.1.cds

Sequence Viewer

Length: 813 bp
atgggttatgcacagctagttattggccctgcaggcagtggcaagtccacttattgctccagtttgcaccgacactgtttggataatggaaggactctacatattgttaacttggatcctgctgcagagcattttgactaccctgtggctttggatatcagggagcttattaacttggatgatgttatggaggaacttggactgggtcccaatggtggacttatgtactgcatggaacaccttgaagataatctggatgattggcttgcagaggggttggaggattacctggatgatgactacttagtttttgactgcccaggccaaatagaacttttttctcatgtgcctatgcttcggaactttgtggaccatttaaagagcaagagtttcaacgtttgtgccgtatacttgcttgattcacagttcatgaccgatgtgaccaagtttatcagtgggtgcatggcatctctttctgcaatggttcaacttgaattaccgcatgttaacattctctccaaaatggatcttgtgacgaacaaaaaggatattgaagatttcttgaatccagagccccaatttttgttgtcagagttgaacaaacgcatggctcctcaatttgcaaagcttaacaagtctttgatggaactggttgacgattatagcatggtgagttttgtgccacttgacttgaggaaggagagcagcataaaatatgtattggctcaaattgatacctcgattcagtttggagaagatgctgatgtgaaggttaaggattttgatccagaagatccagaaaacgacagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

270

Amino Acids

30.48

Weight (kDa)

4.35

Isoelectric Point (pI)

41.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 408
AciI CCGC 1 cut(s) 500
AclI AACGTT 1 cut(s) 396
AclWI GGATC 5 cut(s) 110, 123, 534, 779, 788
AfaI GTAC 1 cut(s) 227
AfiI CCNNNNNNNGG 1 cut(s) 215
AgsI TTSAA 7 cut(s) 245, 394, 488, 494, 554, 565, 598
AjnI CCWGG 2 cut(s) 288, 319
AluBI AGCT 4 cut(s) 16, 166, 628, 810
AluI AGCT 4 cut(s) 16, 166, 628, 810
AlwI GGATC 5 cut(s) 110, 123, 534, 779, 788
AoxI GGCC 2 cut(s) 25, 322
ApeKI GCWGC 2 cut(s) 122, 705
AspS9I GGNCC 3 cut(s) 26, 206, 370
AsuHPI GGTGA 1 cut(s) 682
AvaII GGWCC 2 cut(s) 206, 370
BamHI GGATCC 1 cut(s) 115
BanII GRGCYC 1 cut(s) 576
BbvI GCAGC 2 cut(s) 109, 717
BccI CCATC 1 cut(s) 637
BceAI ACGGC 1 cut(s) 389
BciT130I CCWGG 2 cut(s) 290, 321
BfaI CTAG 1 cut(s) 17
BfmI CTRYAG 2 cut(s) 30, 123
BglI GCCNNNNNGGC 1 cut(s) 33
BisI GCNGC 2 cut(s) 123, 706
BlsI GCNGC 2 cut(s) 124, 707
Bme1390I CCNGG 2 cut(s) 290, 321
Bme18I GGWCC 2 cut(s) 206, 370
BmgT120I GGNCC 3 cut(s) 26, 206, 370
BmiI GGNNCC 4 cut(s) 117, 207, 208, 612
BmrFI CCNGG 2 cut(s) 290, 321
BmrI ACTGGG 1 cut(s) 212
BmsI GCATC 2 cut(s) 476, 748
BmuI ACTGGG 1 cut(s) 212
BpmI CTGGAG 1 cut(s) 43
BpuEI CTTGAG 1 cut(s) 712
BsaBI GATNNNNATC 1 cut(s) 783
BsaJI CCNNGG 1 cut(s) 319
BsaXI ACNNNNNCTCC 2 cut(s) 500, 530
Bsc4I CCNNNNNNNGG 1 cut(s) 215
Bse1I ACTGG 3 cut(s) 60, 207, 654
Bse3DI GCAATG 1 cut(s) 486
Bse8I GATNNNNATC 1 cut(s) 783
BseBI CCWGG 2 cut(s) 290, 321
BseDI CCNNGG 1 cut(s) 319
BseGI GGATG 3 cut(s) 184, 262, 298
BseJI GATNNNNATC 1 cut(s) 783
BseLI CCNNNNNNNGG 1 cut(s) 215
BseMI GCAATG 1 cut(s) 486
BseNI ACTGG 3 cut(s) 60, 207, 654
BseRI GAGGAG 1 cut(s) 603
BseXI GCAGC 2 cut(s) 109, 717
BshFI GGCC 2 cut(s) 27, 324
BslFI GGGAC 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 215
BsmFI GGGAC 1 cut(s) 192
BsnI GGCC 2 cut(s) 27, 324
Bsp1286I GDGCHC 1 cut(s) 576
Bsp143I GATC 4 cut(s) 115, 526, 784, 793
BspACI CCGC 1 cut(s) 500
BspANI GGCC 2 cut(s) 27, 324
BspHI TCATGA 1 cut(s) 429
BspLI GGNNCC 4 cut(s) 117, 207, 208, 612
BspMAI CTGCAG 2 cut(s) 34, 127
BspPI GGATC 5 cut(s) 110, 123, 534, 779, 788
BsrDI GCAATG 1 cut(s) 486
BsrI ACTGG 3 cut(s) 60, 207, 654
BssECI CCNNGG 1 cut(s) 319
BssMI GATC 4 cut(s) 115, 526, 784, 793
BssNAI GTATAC 1 cut(s) 409
Bst1107I GTATAC 1 cut(s) 409
Bst2UI CCWGG 2 cut(s) 290, 321
Bst4CI ACNGT 2 cut(s) 77, 426
BstC8I GCNNGC 2 cut(s) 34, 267
BstDEI CTNAG 1 cut(s) 304
BstF5I GGATG 3 cut(s) 184, 262, 298
BstKTI GATC 4 cut(s) 118, 529, 787, 796
BstMBI GATC 4 cut(s) 115, 526, 784, 793
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstNI CCWGG 2 cut(s) 290, 321
BstNSI RCATGY 1 cut(s) 506
BstSCI CCNGG 2 cut(s) 288, 319
BstSFI CTRYAG 2 cut(s) 30, 123
BstV1I GCAGC 2 cut(s) 109, 717
BstX2I RGATCY 3 cut(s) 115, 526, 793
BstYI RGATCY 3 cut(s) 115, 526, 793
BstZ17I GTATAC 1 cut(s) 409
BsuRI GGCC 2 cut(s) 27, 324
BtsCI GGATG 3 cut(s) 184, 262, 298
BtsI GCAGTG 1 cut(s) 43
BtsIMutI CAGTG 3 cut(s) 43, 73, 460
Cac8I GCNNGC 2 cut(s) 34, 267
CciI TCATGA 1 cut(s) 429
Cfr13I GGNCC 3 cut(s) 26, 206, 370
Csp6I GTAC 1 cut(s) 226
CspCI CAANNNNNGTGG 2 cut(s) 672, 707
CviAII CATG 7 cut(s) 232, 344, 430, 463, 503, 607, 667
CviQI GTAC 1 cut(s) 226
DdeI CTNAG 1 cut(s) 304
DpnI GATC 4 cut(s) 117, 528, 786, 795
DpnII GATC 4 cut(s) 115, 526, 784, 793
DraI TTTAAA 1 cut(s) 378
Eco24I GRGCYC 1 cut(s) 576
Eco32I GATATC 1 cut(s) 157
Eco47I GGWCC 2 cut(s) 206, 370
EcoO109I RGGNCCY 1 cut(s) 206
EcoRII CCWGG 2 cut(s) 288, 319
EcoRV GATATC 1 cut(s) 157
EcoT38I GRGCYC 1 cut(s) 576
FaeI CATG 7 cut(s) 235, 347, 433, 466, 506, 610, 670
FaqI GGGAC 1 cut(s) 192
FatI CATG 7 cut(s) 231, 343, 429, 462, 502, 606, 666
FblI GTMKAC 1 cut(s) 408
Fnu4HI GCNGC 2 cut(s) 123, 706
FokI GGATG 3 cut(s) 191, 269, 305
FriOI GRGCYC 1 cut(s) 576
Fsp4HI GCNGC 2 cut(s) 123, 706
FspBI CTAG 1 cut(s) 17
GluI GCNGC 2 cut(s) 123, 706
GsuI CTGGAG 1 cut(s) 43
HaeIII GGCC 2 cut(s) 27, 324
Hin1II CATG 7 cut(s) 235, 347, 433, 466, 506, 610, 670
HincII GTYRAC 3 cut(s) 109, 508, 655
HindII GTYRAC 3 cut(s) 109, 508, 655
HindIII AAGCTT 1 cut(s) 626
HinfI GANTC 4 cut(s) 94, 419, 565, 742
HpaI GTTAAC 2 cut(s) 109, 508
HphI GGTGA 1 cut(s) 682
Hpy166II GTNNAC 7 cut(s) 48, 109, 218, 370, 409, 508, 655
Hpy188I TCNGA 2 cut(s) 360, 592
Hpy188III TCNNGA 6 cut(s) 254, 430, 562, 569, 788, 797
Hpy8I GTNNAC 7 cut(s) 48, 109, 218, 370, 409, 508, 655
HpyAV CCTTC 3 cut(s) 84, 691, 763
HpyCH4III ACNGT 2 cut(s) 77, 426
HpyCH4IV ACGT 1 cut(s) 396
HpyCH4V TGCA 9 cut(s) 11, 32, 67, 125, 231, 269, 462, 479, 623
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 304
HpySE526I ACGT 1 cut(s) 396
Hsp92II CATG 7 cut(s) 235, 347, 433, 466, 506, 610, 670
KflI GGGWCCC 1 cut(s) 206
KspAI GTTAAC 2 cut(s) 109, 508
Kzo9I GATC 4 cut(s) 115, 526, 784, 793
LmnI GCTCC 3 cut(s) 62, 163, 616
Lsp1109I GCAGC 2 cut(s) 109, 717
LweI GCATC 2 cut(s) 476, 748
MaeI CTAG 1 cut(s) 17
MaeII ACGT 1 cut(s) 396
MaeIII GTNAC 2 cut(s) 439, 532
MalI GATC 4 cut(s) 117, 528, 786, 795
MboI GATC 4 cut(s) 115, 526, 784, 793
MboII GAAGA 4 cut(s) 257, 566, 767, 803
MflI RGATCY 3 cut(s) 115, 526, 793
MhlI GDGCHC 1 cut(s) 576
MluCI AATT 4 cut(s) 494, 578, 617, 729
MlyI GAGTC 1 cut(s) 88
MmeI TCCRAC 1 cut(s) 258
MnlI CCTC 6 cut(s) 184, 265, 274, 624, 687, 748
MseI TTAA 6 cut(s) 108, 171, 377, 507, 630, 774
MspA1I CMGCKG 1 cut(s) 810
MspR9I CCNGG 2 cut(s) 290, 321
MvaI CCWGG 2 cut(s) 290, 321
MwoI GCNNNNNNNGC 1 cut(s) 33
NdeII GATC 4 cut(s) 115, 526, 784, 793
NlaIII CATG 7 cut(s) 235, 347, 433, 466, 506, 610, 670
NlaIV GGNNCC 4 cut(s) 117, 207, 208, 612
NmuCI GTSAC 2 cut(s) 439, 532
NspI RCATGY 1 cut(s) 506
PagI TCATGA 1 cut(s) 429
PcsI WCGNNNNNNNCGW 1 cut(s) 402
PfeI GAWTC 3 cut(s) 419, 565, 742
PflFI GACNNNGTC 1 cut(s) 204
PkrI GCNGC 2 cut(s) 124, 707
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PpuMI RGGWCCY 1 cut(s) 206
Psp1406I AACGTT 1 cut(s) 396
Psp5II RGGWCCY 1 cut(s) 206
Psp6I CCWGG 2 cut(s) 288, 319
PspGI CCWGG 2 cut(s) 288, 319
PspN4I GGNNCC 4 cut(s) 117, 207, 208, 612
PspPI GGNCC 3 cut(s) 26, 206, 370
PspPPI RGGWCCY 1 cut(s) 206
PstI CTGCAG 2 cut(s) 34, 127
PsuI RGATCY 3 cut(s) 115, 526, 793
PsyI GACNNNGTC 1 cut(s) 204
PvuII CAGCTG 1 cut(s) 810
RsaI GTAC 1 cut(s) 227
RsaNI GTAC 1 cut(s) 226
SaqAI TTAA 6 cut(s) 108, 171, 377, 507, 630, 774
SatI GCNGC 2 cut(s) 123, 706
Sau3AI GATC 4 cut(s) 115, 526, 784, 793
Sau96I GGNCC 3 cut(s) 26, 206, 370
SbfI CCTGCAGG 1 cut(s) 34
SchI GAGTC 1 cut(s) 88
ScrFI CCNGG 2 cut(s) 290, 321
SdaI CCTGCAGG 1 cut(s) 34
SduI GDGCHC 1 cut(s) 576
SetI ASST 9 cut(s) 18, 168, 243, 291, 399, 630, 740, 774, 812
SfaNI GCATC 2 cut(s) 476, 748
SfcI CTRYAG 2 cut(s) 30, 123
SinI GGWCC 2 cut(s) 206, 370
SmlI CTYRAG 1 cut(s) 691
SmoI CTYRAG 1 cut(s) 691
Sse8387I CCTGCAGG 1 cut(s) 34
Sse9I AATT 4 cut(s) 494, 578, 617, 729
SsiI CCGC 1 cut(s) 500
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 2 cut(s) 288, 319
TaaI ACNGT 2 cut(s) 77, 426
TaiI ACGT 1 cut(s) 399
TaqI TCGA 1 cut(s) 740
TaqII GACCGA 1 cut(s) 449
TasI AATT 4 cut(s) 494, 578, 617, 729
TatI WGTACW 1 cut(s) 225
TfiI GAWTC 3 cut(s) 419, 565, 742
Tru1I TTAA 6 cut(s) 108, 171, 377, 507, 630, 774
Tru9I TTAA 6 cut(s) 108, 171, 377, 507, 630, 774
TscAI CASTG 3 cut(s) 43, 80, 460
TseFI GTSAC 2 cut(s) 439, 532
TseI GCWGC 2 cut(s) 122, 705
Tsp45I GTSAC 2 cut(s) 439, 532
TspDTI ATGAA 1 cut(s) 418
TspRI CASTG 3 cut(s) 43, 80, 460
Tth111I GACNNNGTC 1 cut(s) 204
VpaK11BI GGWCC 2 cut(s) 206, 370
XceI RCATGY 1 cut(s) 506
XmiI GTMKAC 1 cut(s) 408
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.