pycom17g13810

GPN-loop GTPase 3

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
11377333 .. 11379062
1730 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g13810.1

Sequence Viewer

Length: 339 bp
ATGGCATCTCTTTCTGCCATGATTCAACTTGAATTACCACATGTTAATATTCTCTCCAAAATGGACCTTGCACCGAGAAAAAAGGATATTGAAGACTTCTTGTATCCGGAGCCTCAAGTTTTATTGTCAGAGTTGAATCAACGCATGGCTCCTCAGTTTGCAAAGCTAAATAAATCTTTGATTGAACTAGTCGATGATTATAGCATGGTGAGTTTTGTGCCACTAGACTTGAGGAAGTCAAGCAGCATGAGCTATGTCTTGGCTCAGATTGATACCTGCATTCAGTTCGGAGAAGATGCCGATGTGAAGGTTAAGGAATTTGATCAGGAAGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.78

Weight (kDa)

4.44

Isoelectric Point (pI)

53.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP_bind_1 PF03029 1 - 95 1.7e-15 Conserved hypothetical ATP binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 284
AccIII TCCGGA 1 cut(s) 106
AcsI RAATTY 1 cut(s) 317
AflIII ACRYGT 1 cut(s) 40
AgsI TTSAA 5 cut(s) 26, 32, 92, 136, 185
AhlI ACTAGT 1 cut(s) 187
AluBI AGCT 2 cut(s) 166, 252
AluI AGCT 2 cut(s) 166, 252
Aor13HI TCCGGA 1 cut(s) 106
ApeKI GCWGC 1 cut(s) 243
ApoI RAATTY 1 cut(s) 317
AspS9I GGNCC 1 cut(s) 64
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 64
BbsI GAAGAC 1 cut(s) 99
BbvI GCAGC 1 cut(s) 255
BcgI CGANNNNNNTGC 2 cut(s) 268, 302
BciVI GTATCC 1 cut(s) 114
BclI TGATCA 1 cut(s) 322
BcuI ACTAGT 1 cut(s) 187
BfaI CTAG 2 cut(s) 188, 224
BfuAI ACCTGC 1 cut(s) 284
BfuI GTATCC 1 cut(s) 114
BisI GCNGC 1 cut(s) 244
BlsI GCNGC 1 cut(s) 245
Bme18I GGWCC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 64
BmiI GGNNCC 2 cut(s) 111, 150
BmsI GCATC 2 cut(s) 14, 286
BpiI GAAGAC 1 cut(s) 99
BpuEI CTTGAG 2 cut(s) 99, 250
BsaWI WCCGGW 1 cut(s) 106
BseAI TCCGGA 1 cut(s) 106
BseMII CTCAG 2 cut(s) 167, 278
BseRI GAGGAG 1 cut(s) 141
BseXI GCAGC 1 cut(s) 255
BsiSI CCGG 1 cut(s) 107
BsmI GAATGC 1 cut(s) 279
Bsp13I TCCGGA 1 cut(s) 106
Bsp143I GATC 1 cut(s) 322
BspCNI CTCAG 2 cut(s) 166, 277
BspEI TCCGGA 1 cut(s) 106
BspLI GGNNCC 2 cut(s) 111, 150
BspMI ACCTGC 1 cut(s) 284
BssMI GATC 1 cut(s) 322
BstDEI CTNAG 2 cut(s) 153, 264
BstKTI GATC 1 cut(s) 325
BstMBI GATC 1 cut(s) 322
BstMWI GCNNNNNNNGC 1 cut(s) 249
BstNSI RCATGY 1 cut(s) 44
BstV1I GCAGC 1 cut(s) 255
BstV2I GAAGAC 1 cut(s) 99
BsuI GTATCC 1 cut(s) 114
BveI ACCTGC 1 cut(s) 284
Cfr13I GGNCC 1 cut(s) 64
CspCI CAANNNNNGTGG 2 cut(s) 210, 245
CviAII CATG 5 cut(s) 19, 41, 145, 205, 247
CviJI RGCY 5 cut(s) 112, 149, 166, 252, 263
CviKI_1 RGCY 5 cut(s) 112, 149, 166, 252, 263
DdeI CTNAG 2 cut(s) 153, 264
DpnI GATC 1 cut(s) 324
DpnII GATC 1 cut(s) 322
Eco47I GGWCC 1 cut(s) 64
FaeI CATG 5 cut(s) 22, 44, 148, 208, 250
FaiI YATR 7 cut(s) 20, 42, 146, 201, 206, 248, 255
FatI CATG 5 cut(s) 18, 40, 144, 204, 246
FbaI TGATCA 1 cut(s) 322
Fnu4HI GCNGC 1 cut(s) 244
Fsp4HI GCNGC 1 cut(s) 244
FspBI CTAG 2 cut(s) 188, 224
GluI GCNGC 1 cut(s) 244
HapII CCGG 1 cut(s) 107
Hin1II CATG 5 cut(s) 22, 44, 148, 208, 250
HinfI GANTC 2 cut(s) 22, 136
HpaII CCGG 1 cut(s) 107
HphI GGTGA 1 cut(s) 220
Hpy188I TCNGA 3 cut(s) 130, 267, 290
Hpy188III TCNNGA 2 cut(s) 107, 326
HpyAV CCTTC 1 cut(s) 301
HpyCH4V TGCA 3 cut(s) 71, 161, 279
HpyF10VI GCNNNNNNNGC 1 cut(s) 249
HpyF3I CTNAG 2 cut(s) 153, 264
Hsp92II CATG 5 cut(s) 22, 44, 148, 208, 250
Kpn2I TCCGGA 1 cut(s) 106
Ksp22I TGATCA 1 cut(s) 322
Kzo9I GATC 1 cut(s) 322
LmnI GCTCC 2 cut(s) 109, 154
LpnPI CCDG 3 cut(s) 120, 289, 311
Lsp1109I GCAGC 1 cut(s) 255
LweI GCATC 2 cut(s) 14, 286
MaeI CTAG 2 cut(s) 188, 224
MalI GATC 1 cut(s) 324
MboI GATC 1 cut(s) 322
MboII GAAGA 2 cut(s) 104, 305
MluCI AATT 2 cut(s) 32, 317
MnlI CCTC 3 cut(s) 123, 162, 225
MroI TCCGGA 1 cut(s) 106
MseI TTAA 2 cut(s) 45, 312
MspI CCGG 1 cut(s) 107
Mva1269I GAATGC 1 cut(s) 279
MwoI GCNNNNNNNGC 1 cut(s) 249
NdeII GATC 1 cut(s) 322
NlaIII CATG 5 cut(s) 22, 44, 148, 208, 250
NlaIV GGNNCC 2 cut(s) 111, 150
NspI RCATGY 1 cut(s) 44
PciI ACATGT 1 cut(s) 40
PctI GAATGC 1 cut(s) 279
PfeI GAWTC 2 cut(s) 22, 136
PkrI GCNGC 1 cut(s) 245
PscI ACATGT 1 cut(s) 40
PspN4I GGNNCC 2 cut(s) 111, 150
PspPI GGNCC 1 cut(s) 64
SaqAI TTAA 2 cut(s) 45, 312
SatI GCNGC 1 cut(s) 244
Sau3AI GATC 1 cut(s) 322
Sau96I GGNCC 1 cut(s) 64
SetI ASST 5 cut(s) 69, 168, 254, 278, 312
SfaNI GCATC 2 cut(s) 14, 286
SinI GGWCC 1 cut(s) 64
SmlI CTYRAG 2 cut(s) 114, 229
SmoI CTYRAG 2 cut(s) 114, 229
SpeI ACTAGT 1 cut(s) 187
Sse9I AATT 2 cut(s) 32, 317
SspI AATATT 1 cut(s) 49
SspMI CTAG 2 cut(s) 188, 224
TaqI TCGA 1 cut(s) 192
TasI AATT 2 cut(s) 32, 317
TfiI GAWTC 2 cut(s) 22, 136
Tru1I TTAA 2 cut(s) 45, 312
Tru9I TTAA 2 cut(s) 45, 312
TseI GCWGC 1 cut(s) 243
VpaK11BI GGWCC 1 cut(s) 64
XapI RAATTY 1 cut(s) 317
XceI RCATGY 1 cut(s) 44
XspI CTAG 2 cut(s) 188, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.