MD02G1139000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0002579
Physical Location & Seq
Reverse (-)
11606865 .. 11609015
2151 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1139000.v1.1.491

Sequence Viewer

Length: 159 bp
ATGAAGTATGAGAGTGTGAGTGACACAAGGCAAAGTTACACCCGACACGAAGATCTTAATACTGCCTTTGCCAGTGAAGCCTCTTGGGAACGTTCACCTTCTCATACTCCTACTCGAGGAACACCGAGGCCCAATGAAAGAAGATATGGTGCAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.03

Weight (kDa)

8.23

Isoelectric Point (pI)

53.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 116
Ama87I CYCGRG 1 cut(s) 114
AoxI GGCC 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 129
AsuHPI GGTGA 1 cut(s) 87
AvaI CYCGRG 1 cut(s) 114
BglII AGATCT 1 cut(s) 52
BmeT110I CYCGRG 1 cut(s) 114
BmgT120I GGNCC 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse1I ACTGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 72
BshFI GGCC 1 cut(s) 130
BsiHKCI CYCGRG 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 116
BsnI GGCC 1 cut(s) 130
BsoBI CYCGRG 1 cut(s) 114
Bsp143I GATC 1 cut(s) 52
BspANI GGCC 1 cut(s) 130
BsrI ACTGG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 125
BssMI GATC 1 cut(s) 52
BstENI CCTNNNNNAGG 1 cut(s) 114
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BsuRI GGCC 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 129
CviJI RGCY 2 cut(s) 80, 130
CviKI_1 RGCY 2 cut(s) 80, 130
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco88I CYCGRG 1 cut(s) 114
EcoNI CCTNNNNNAGG 1 cut(s) 114
FaiI YATR 3 cut(s) 9, 105, 147
HaeIII GGCC 1 cut(s) 130
HphI GGTGA 1 cut(s) 87
Hpy166II GTNNAC 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 108
HpyCH4IV ACGT 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpySE526I ACGT 1 cut(s) 91
Kzo9I GATC 1 cut(s) 52
LpnPI CCDG 1 cut(s) 85
MaeII ACGT 1 cut(s) 91
MaeIII GTNAC 2 cut(s) 20, 35
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 2 cut(s) 62, 153
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 153
MnlI CCTC 3 cut(s) 91, 110, 120
MseI TTAA 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 77
NdeII GATC 1 cut(s) 52
NmuCI GTSAC 1 cut(s) 20
PaeR7I CTCGAG 1 cut(s) 114
Psp1406I AACGTT 1 cut(s) 91
PspPI GGNCC 1 cut(s) 129
PspXI VCTCGAGB 1 cut(s) 114
PsuI RGATCY 1 cut(s) 52
SaqAI TTAA 1 cut(s) 57
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 129
SetI ASST 2 cut(s) 94, 100
Sfr274I CTCGAG 1 cut(s) 114
SgeI CNNG 8 cut(s) 39, 54, 59, 84, 96, 126, 128, 138
SlaI CTCGAG 1 cut(s) 114
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
Sse9I AATT 1 cut(s) 153
TaiI ACGT 1 cut(s) 94
TaqI TCGA 1 cut(s) 115
TasI AATT 1 cut(s) 153
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TscAI CASTG 1 cut(s) 79
TseFI GTSAC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 20
TspDTI ATGAA 2 cut(s) 17, 150
TspRI CASTG 1 cut(s) 79
XagI CCTNNNNNAGG 1 cut(s) 114
XhoI CTCGAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.