Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0002579

Physical Location & Seq

Genomic Coordinates Reverse (-)

17053023 .. 17057292

Gene Structure 4270 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00095660.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGGGAAAGCGTGGTATTGATGCATTGCCTGGCATGACAATTGTATCTGCTTACTTAGAAACTGTGAGTGGAGCAGGGCAAAGCTACAGCCGAGCAGAAGATCTTAATAGTTCCTTTGCCAGTGAAGCTTCTTTGGAACACCCGCCTGCTTCTTATCAAGGAACGCAGAGGCCAGCAACTGAAAGAAAATATGGTGCAATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

67

Amino Acids

7.08

Weight (kDa)

5.64

Isoelectric Point (pI)

36.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002579)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G36440
fragaria_vesca	FvH4_1g12510 FvH4_1g12510 FvH4_1g12510 FvH4_1g12510 FvH4_1g12510 FvH4_1g12510
malus_domestica	MD02G1139000.v1.1 MD15G1252400.v1.1
prunus_persica	Prupe.7G161800_v2.0.a1
pyrus_communis	pycom15g22230
rosa_chinensis	RchiOBHm_Chr2g0100411 RchiOBHm_Chr2g0136281
rosa_laevigata	RLG00000016971 RLG00000016995
rosa_multiflora	Rmu_sc0001095.1_g000010 Rmu_sc0005038.1_g000024 Rmu_sc0005093.1_g000022 Rmu_ssc0000008.1_g000012
rosa_roxburghii	Rroxscaffold_2G00095660 Rroxscaffold_2G00142270 Rroxscaffold_3G00237860 Rroxscaffold_4G00320340 Rroxscaffold_7G00196390
rosa_rugosa	Rorug02G0087900 Rorug02G0088000 Rorug02G0088100
rosa_samantha	Rh2AG137400 Rh2AG137600 Rh2BG140600 Rh2BG140800 Rh2CG142700 Rh2DG142600 Rh3DG330200 Rh4AG080100 Rh4CG086200 Rh4CG256300 Rh5AG182400
rosa_wichuraiana	Rw2G010750 Rw7G016510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	143
AjnI	CCWGG	1 cut(s)	28
AluBI	AGCT	2 cut(s)	84, 128
AluI	AGCT	2 cut(s)	84, 128
AlwNI	CAGNNNCTG	1 cut(s)	179
AoxI	GGCC	1 cut(s)	170
BaeI	ACNNNNGTAYC	2 cut(s)	27, 60
BciT130I	CCWGG	1 cut(s)	30
BfmI	CTRYAG	1 cut(s)	85
BglII	AGATCT	1 cut(s)	100
Bme1390I	CCNGG	1 cut(s)	30
BmrFI	CCNGG	1 cut(s)	30
BmsI	GCATC	1 cut(s)	10
Bse1I	ACTGG	1 cut(s)	120
Bse3DI	GCAATG	1 cut(s)	23
BseBI	CCWGG	1 cut(s)	30
BseMI	GCAATG	1 cut(s)	23
BseNI	ACTGG	1 cut(s)	120
BshFI	GGCC	1 cut(s)	172
BsnI	GGCC	1 cut(s)	172
Bsp143I	GATC	1 cut(s)	100
BspACI	CCGC	1 cut(s)	143
BspANI	GGCC	1 cut(s)	172
BsrDI	GCAATG	1 cut(s)	23
BsrI	ACTGG	1 cut(s)	120
BssMI	GATC	1 cut(s)	100
Bst2UI	CCWGG	1 cut(s)	30
Bst4CI	ACNGT	1 cut(s)	64
BstC8I	GCNNGC	2 cut(s)	147, 174
BstDEI	CTNAG	1 cut(s)	55
BstKTI	GATC	1 cut(s)	103
BstMBI	GATC	1 cut(s)	100
BstMWI	GCNNNNNNNGC	1 cut(s)	125
BstNI	CCWGG	1 cut(s)	30
BstSCI	CCNGG	1 cut(s)	28
BstSFI	CTRYAG	1 cut(s)	85
BstX2I	RGATCY	1 cut(s)	100
BstYI	RGATCY	1 cut(s)	100
BsuRI	GGCC	1 cut(s)	172
BtsIMutI	CAGTG	1 cut(s)	127
Cac8I	GCNNGC	2 cut(s)	147, 174
CaiI	CAGNNNCTG	1 cut(s)	179
CviAII	CATG	1 cut(s)	34
CviJI	RGCY	4 cut(s)	84, 90, 128, 172
CviKI_1	RGCY	4 cut(s)	84, 90, 128, 172
DdeI	CTNAG	1 cut(s)	55
DpnI	GATC	1 cut(s)	102
DpnII	GATC	1 cut(s)	100
EcoRII	CCWGG	1 cut(s)	28
EcoT22I	ATGCAT	1 cut(s)	25
FaeI	CATG	1 cut(s)	37
FaiI	YATR	2 cut(s)	35, 192
FatI	CATG	1 cut(s)	33
FauI	CCCGC	1 cut(s)	150
HaeIII	GGCC	1 cut(s)	172
Hin1II	CATG	1 cut(s)	37
HindIII	AAGCTT	1 cut(s)	126
HpyCH4III	ACNGT	1 cut(s)	64
HpyCH4V	TGCA	2 cut(s)	23, 197
HpyF10VI	GCNNNNNNNGC	1 cut(s)	125
HpyF3I	CTNAG	1 cut(s)	55
Hsp92II	CATG	1 cut(s)	37
Kzo9I	GATC	1 cut(s)	100
LmnI	GCTCC	1 cut(s)	71
LpnPI	CCDG	6 cut(s)	15, 42, 60, 133, 159, 186
LweI	GCATC	1 cut(s)	10
MalI	GATC	1 cut(s)	102
MboI	GATC	1 cut(s)	100
MboII	GAAGA	1 cut(s)	110
MfeI	CAATTG	1 cut(s)	39
MflI	RGATCY	1 cut(s)	100
MluCI	AATT	2 cut(s)	39, 198
MnlI	CCTC	1 cut(s)	162
Mph1103I	ATGCAT	1 cut(s)	25
MseI	TTAA	1 cut(s)	105
MspR9I	CCNGG	1 cut(s)	30
MunI	CAATTG	1 cut(s)	39
MvaI	CCWGG	1 cut(s)	30
MwoI	GCNNNNNNNGC	1 cut(s)	125
NdeII	GATC	1 cut(s)	100
NlaIII	CATG	1 cut(s)	37
NmeAIII	GCCGAG	1 cut(s)	116
NsiI	ATGCAT	1 cut(s)	25
Psp6I	CCWGG	1 cut(s)	28
PspGI	CCWGG	1 cut(s)	28
PstNI	CAGNNNCTG	1 cut(s)	179
PsuI	RGATCY	1 cut(s)	100
SaqAI	TTAA	1 cut(s)	105
Sau3AI	GATC	1 cut(s)	100
ScrFI	CCNGG	1 cut(s)	30
SetI	ASST	2 cut(s)	86, 130
SfaNI	GCATC	1 cut(s)	10
SfcI	CTRYAG	1 cut(s)	85
Sse9I	AATT	2 cut(s)	39, 198
SsiI	CCGC	1 cut(s)	143
StyD4I	CCNGG	1 cut(s)	28
TaaI	ACNGT	1 cut(s)	64
TasI	AATT	2 cut(s)	39, 198
Tru1I	TTAA	1 cut(s)	105
Tru9I	TTAA	1 cut(s)	105
TscAI	CASTG	1 cut(s)	127
TspRI	CASTG	1 cut(s)	127
Zsp2I	ATGCAT	1 cut(s)	25

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.