MD07G1004800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
510119 .. 510720
602 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1004800.v1.1.491

Sequence Viewer

Length: 171 bp
ATGACATCGTCACAAGTCTGCGCTGACAAAGGAGGCTCTCCGACTACCGCAAGCTTGCCTGCTTCAAGCGAATCGAAGAAAAGCAAGTCAAAATCATCAGCATATTGGTCTCGCAAGCATGTTTCTAATTATTACATGGAAATACTACTAAATCTCATCAAGGGCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.07

Weight (kDa)

9.67

Isoelectric Point (pI)

56.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 48
AgsI TTSAA 1 cut(s) 66
AluBI AGCT 1 cut(s) 54
AluI AGCT 1 cut(s) 54
Alw26I GTCTC 1 cut(s) 114
AspLEI GCGC 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 114
BsaI GGTCTC 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 114
Bso31I GGTCTC 1 cut(s) 114
BspACI CCGC 1 cut(s) 48
BspTNI GGTCTC 1 cut(s) 114
BstC8I GCNNGC 4 cut(s) 52, 56, 60, 116
BstHHI GCGC 1 cut(s) 23
BstMAI GTCTC 1 cut(s) 114
BstNSI RCATGY 2 cut(s) 122, 169
Cac8I GCNNGC 4 cut(s) 52, 56, 60, 116
CfoI GCGC 1 cut(s) 23
CviAII CATG 3 cut(s) 119, 136, 166
CviJI RGCY 2 cut(s) 36, 54
CviKI_1 RGCY 2 cut(s) 36, 54
Eco31I GGTCTC 1 cut(s) 114
FaeI CATG 3 cut(s) 122, 139, 169
FaiI YATR 4 cut(s) 103, 120, 137, 167
FatI CATG 3 cut(s) 118, 135, 165
FspEI CC 9 cut(s) 15, 18, 54, 61, 72, 91, 122, 146, 147
GlaI GCGC 1 cut(s) 22
HhaI GCGC 1 cut(s) 23
Hin1II CATG 3 cut(s) 122, 139, 169
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HindIII AAGCTT 1 cut(s) 52
HinfI GANTC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 42
Hsp92II CATG 3 cut(s) 122, 139, 169
HspAI GCGC 1 cut(s) 21
LpnPI CCDG 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 9
MboII GAAGA 1 cut(s) 88
MluCI AATT 1 cut(s) 127
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 1 cut(s) 26
NlaIII CATG 3 cut(s) 122, 139, 169
NmuCI GTSAC 1 cut(s) 9
NspI RCATGY 2 cut(s) 122, 169
PfeI GAWTC 1 cut(s) 71
PflFI GACNNNGTC 1 cut(s) 7
PsyI GACNNNGTC 1 cut(s) 7
SetI ASST 1 cut(s) 56
Sse9I AATT 1 cut(s) 127
SsiI CCGC 1 cut(s) 48
TaqI TCGA 1 cut(s) 74
TasI AATT 1 cut(s) 127
TfiI GAWTC 1 cut(s) 71
TseFI GTSAC 1 cut(s) 9
Tsp45I GTSAC 1 cut(s) 9
Tth111I GACNNNGTC 1 cut(s) 7
XceI RCATGY 2 cut(s) 122, 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.