RchiOBHm_Chr2g0123881

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
37155278 .. 37156160
883 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49614

Sequence Viewer

Length: 201 bp
ATGGCCATTTTTTCAGCTCTTCTAAGTTGCTTCATCCCTTCATCATCGCCACAGGTTTCTGATGATGCAGGAAATGCTGGTGTTGCGAAAGCTCCTTCCCCAAAAGATTCCAGAAAGAGTAAATCTCCGAAATCATCGTCATCGCGAGCTCCCATAGTAGTTTCCCACTTCCCTCATAACTCTTATATCTCTCGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

6.9

Weight (kDa)

10.02

Isoelectric Point (pI)

78.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 145
AcoI YGGCCR 1 cut(s) 3
AluBI AGCT 3 cut(s) 17, 92, 149
AluI AGCT 3 cut(s) 17, 92, 149
Alw21I GWGCWC 1 cut(s) 151
AoxI GGCC 1 cut(s) 3
ArsI GACNNNNNNTTYG 2 cut(s) 122, 154
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 151
Bbv12I GWGCWC 1 cut(s) 151
BmsI GCATC 1 cut(s) 55
BplI GAGNNNNNCTC 2 cut(s) 109, 141
BseGI GGATG 1 cut(s) 33
Bsh1236I CGCG 1 cut(s) 145
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 151
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 151
Bsp68I TCGCGA 1 cut(s) 145
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 145
BspQI GCTCTTC 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 24
BstAPI GCANNNNNTGC 1 cut(s) 74
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 33
BstFNI CGCG 1 cut(s) 145
BstMWI GCNNNNNNNGC 2 cut(s) 74, 83
BstUI CGCG 1 cut(s) 145
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 2 cut(s) 30, 126
BtsCI GGATG 1 cut(s) 33
BtuMI TCGCGA 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 147
CviJI RGCY 4 cut(s) 5, 17, 92, 149
CviKI_1 RGCY 4 cut(s) 5, 17, 92, 149
DdeI CTNAG 1 cut(s) 23
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Ecl136II GAGCTC 1 cut(s) 149
Eco24I GRGCYC 1 cut(s) 151
Eco53kI GAGCTC 1 cut(s) 149
EcoICRI GAGCTC 1 cut(s) 149
EcoT38I GRGCYC 1 cut(s) 151
FaiI YATR 3 cut(s) 155, 177, 186
FokI GGATG 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 151
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 61, 129
Hpy188III TCNNGA 2 cut(s) 111, 144
HpyAV CCTTC 2 cut(s) 48, 105
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 83
HpyF3I CTNAG 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 24
LmnI GCTCC 2 cut(s) 97, 154
LpnPI CCDG 4 cut(s) 38, 54, 63, 124
LweI GCATC 1 cut(s) 55
MboII GAAGA 1 cut(s) 11
MhlI GDGCHC 1 cut(s) 151
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 183
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MvnI CGCG 1 cut(s) 145
MwoI GCNNNNNNNGC 2 cut(s) 74, 83
NruI TCGCGA 1 cut(s) 145
PciSI GCTCTTC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 107
Psp124BI GAGCTC 1 cut(s) 151
RruI TCGCGA 1 cut(s) 145
SacI GAGCTC 1 cut(s) 151
SapI GCTCTTC 1 cut(s) 24
SduI GDGCHC 1 cut(s) 151
SetI ASST 4 cut(s) 19, 57, 94, 151
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 6 cut(s) 65, 81, 90, 123, 156, 158
SstI GAGCTC 1 cut(s) 151
TfiI GAWTC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 22, 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.