RchiOBHm_Chr2g0123781

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
37022009 .. 37022810
802 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49605

Sequence Viewer

Length: 192 bp
ATGGCCATTTTTTCAGCTCTTCTCGAGTGCTTCATCCCTTCATCATCGTCACAGGTTTCCGATGATGCAGGAAATGCTAGTATTGCCAAAGCTCCTGATTCCTCAAAGCATTCCAGCAAAAGCAAATCTTCGTCGAAACCTCCCCTAGTAGTTTCTCACTTTCCCCAAAACTCATACATCTCTCGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.63

Weight (kDa)

8.98

Isoelectric Point (pI)

57.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AluBI AGCT 2 cut(s) 17, 92
AluI AGCT 2 cut(s) 17, 92
Ama87I CYCGRG 1 cut(s) 23
AoxI GGCC 1 cut(s) 3
AvaI CYCGRG 1 cut(s) 23
BalI TGGCCA 1 cut(s) 5
BfaI CTAG 2 cut(s) 78, 146
BmeT110I CYCGRG 1 cut(s) 23
BmsI GCATC 1 cut(s) 55
BseGI GGATG 1 cut(s) 33
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 23
BsmI GAATGC 1 cut(s) 109
BsnI GGCC 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 23
BspANI GGCC 1 cut(s) 5
BspQI GCTCTTC 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 24
BstAPI GCANNNNNTGC 1 cut(s) 74
BstF5I GGATG 1 cut(s) 33
BstMWI GCNNNNNNNGC 2 cut(s) 74, 83
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 33
CviJI RGCY 3 cut(s) 5, 17, 92
CviKI_1 RGCY 3 cut(s) 5, 17, 92
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco88I CYCGRG 1 cut(s) 23
FaiI YATR 1 cut(s) 175
FalI AAGNNNNNCTT 2 cut(s) 112, 144
FokI GGATG 1 cut(s) 20
FspBI CTAG 2 cut(s) 78, 146
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 23, 95
Hpy99I CGWCG 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 83
LguI GCTCTTC 1 cut(s) 24
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 4 cut(s) 38, 54, 108, 127
LweI GCATC 1 cut(s) 55
MaeI CTAG 2 cut(s) 78, 146
MaeIII GTNAC 1 cut(s) 48
MboII GAAGA 2 cut(s) 11, 120
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 112, 150
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
Mva1269I GAATGC 1 cut(s) 109
MwoI GCNNNNNNNGC 2 cut(s) 74, 83
NmuCI GTSAC 1 cut(s) 48
PaeR7I CTCGAG 1 cut(s) 23
PciSI GCTCTTC 1 cut(s) 24
PctI GAATGC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 98
SapI GCTCTTC 1 cut(s) 24
SetI ASST 4 cut(s) 19, 57, 94, 142
SfaNI GCATC 1 cut(s) 55
Sfr274I CTCGAG 1 cut(s) 23
SgeI CNNG 8 cut(s) 35, 37, 65, 81, 90, 107, 126, 158
SlaI CTCGAG 1 cut(s) 23
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
SspMI CTAG 2 cut(s) 78, 146
TaqI TCGA 2 cut(s) 24, 134
TfiI GAWTC 1 cut(s) 98
TseFI GTSAC 1 cut(s) 48
Tsp45I GTSAC 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 22, 30
XhoI CTCGAG 1 cut(s) 23
XspI CTAG 2 cut(s) 78, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.