Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003270.1

Orthogroup ID

OG0002398

Physical Location & Seq

Genomic Coordinates Forward (+)

148352 .. 149266

Gene Structure 915 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003270.1_g000037.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 654 bp

atgtcgttgaaacctcagctccctcccaatccccacctttctccgcctccgaccgagatcaatcagcttctcatctcaggtagtaataccgacaccgacaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgatagcaccgccgccaccttgactaccaaaaacgtcacagtttggaaccctgggggatccgctctttctactcctctagtttcctccttcgtttcaggtaatttctctgctccgcttcattgttgtacttcctttacggatagagagggctggttcgaggagttgaaagccgagtttaaggggaagatttggcatcgtatacacctggaaagtgtgagggttaggctgattgccaaggatattattgatgctttaaacagagggttgaggcatgatcaggagtggactgacatgggggatgcatcggtggaggtcgactggaattcgaaggccgggggatggattgagcatagtaggaagaagggtaaggatagtggtgttaaggatgccacttcgcatttggttgatttggattgggagattttggtggtggatgagccgaatgtcaatgcgttttgcttgccgggtgggaagattgatgccttcacagggttgatattattcttttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004175 GO:0004222 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005740 GO:0005743 GO:0006508 GO:0006515 GO:0006807 GO:0006996 GO:0007005 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0008233 GO:0008237 GO:0009056 GO:0009057 GO:0009987 GO:0016020 GO:0016043 GO:0016787 GO:0019538 GO:0019866 GO:0023052 GO:0030163 GO:0031090 GO:0031929 GO:0031966 GO:0031967 GO:0031975 GO:0035556 GO:0035694 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044422 GO:0044424 GO:0044429 GO:0044444 GO:0044446 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051603 GO:0051716 GO:0065007 GO:0070011 GO:0071704 GO:0071840 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_M48

Protein Analysis

217

Amino Acids

23.75

Weight (kDa)

5.3

Isoelectric Point (pI)

27.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002398)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g25611
malus_domestica	MD07G1004800.v1.1
prunus_persica	Prupe.2G006100_v2.0.a1 Prupe.2G006200_v2.0.a1 Prupe.2G006300_v2.0.a1 Prupe.2G006400_v2.0.a1 Prupe.2G006700_v2.0.a1 Prupe.2G006800_v2.0.a1 Prupe.2G006900_v2.0.a1
pyrus_communis	pycom02g26560 pycom07g00370
rosa_chinensis	RchiOBHm_Chr1g0314271 RchiOBHm_Chr1g0314291 RchiOBHm_Chr2g0123781 RchiOBHm_Chr2g0123791 RchiOBHm_Chr2g0123801 RchiOBHm_Chr2g0123821 RchiOBHm_Chr2g0123871 RchiOBHm_Chr2g0123881 RchiOBHm_Chr2g0123891
rosa_laevigata	RLG00000018776
rosa_multiflora	Rmu_sc0003270.1_g000037
rosa_roxburghii	Rroxscaffold_2G00120260 Rroxscaffold_2G00120270 Rroxscaffold_2G00120290 Rroxscaffold_2G00120310 Rroxscaffold_2G00120320 Rroxscaffold_2G00120330 Rroxscaffold_2G00120340 Rroxscaffold_4G00331990
rosa_rugosa	Rorug02G0248000 Rorug02G0248200
rosa_samantha	Rh2BG315500 Rh2CG293300 Rh2DG330700
rosa_wichuraiana	Rw1G000430 Rw2G024630 Rw2G024640 Rw2G024650 Rw2G024670 Rw2G024680 Rw2G024700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	206
AccI	GTMKAC	2 cut(s)	343, 459
AciI	CCGC	5 cut(s)	44, 153, 156, 204, 257
AclWI	GGATC	2 cut(s)	195, 208
AcsI	RAATTY	1 cut(s)	466
AfaI	GTAC	1 cut(s)	271
AfiI	CCNNNNNNNGG	2 cut(s)	483, 633
AgsI	TTSAA	2 cut(s)	10, 310
AjnI	CCWGG	2 cut(s)	193, 348
AluBI	AGCT	2 cut(s)	19, 67
AluI	AGCT	2 cut(s)	19, 67
AlwI	GGATC	2 cut(s)	195, 208
AoxI	GGCC	1 cut(s)	474
ApoI	RAATTY	1 cut(s)	466
AsuC2I	CCSGG	2 cut(s)	478, 609
AsuHPI	GGTGA	7 cut(s)	97, 103, 109, 115, 121, 127, 133
AsuII	TTCGAA	1 cut(s)	470
BamHI	GGATCC	1 cut(s)	200
BbvCI	CCTCAGC	1 cut(s)	15
BccI	CCATC	1 cut(s)	477
BciT130I	CCWGG	2 cut(s)	195, 350
BclI	TGATCA	1 cut(s)	418
BcnI	CCSGG	2 cut(s)	478, 609
BfaI	CTAG	1 cut(s)	221
BisI	GCNGC	1 cut(s)	156
BlsI	GCNGC	1 cut(s)	157
Bme1390I	CCNGG	4 cut(s)	195, 350, 478, 609
BmiI	GGNNCC	2 cut(s)	191, 202
BmrFI	CCNGG	4 cut(s)	195, 350, 478, 609
BmsI	GCATC	6 cut(s)	346, 382, 433, 455, 520, 613
Bpu10I	CCTNAGC	1 cut(s)	15
Bpu14I	TTCGAA	1 cut(s)	470
BpuMI	CCSGG	2 cut(s)	478, 609
BsaJI	CCNNGG	4 cut(s)	193, 194, 378, 477
BsaXI	ACNNNNNCTCC	1 cut(s)	33
Bsc4I	CCNNNNNNNGG	2 cut(s)	483, 633
Bse1I	ACTGG	1 cut(s)	467
BseBI	CCWGG	2 cut(s)	195, 350
BseDI	CCNNGG	4 cut(s)	193, 194, 378, 477
BseGI	GGATG	4 cut(s)	448, 488, 535, 583
BseLI	CCNNNNNNNGG	2 cut(s)	483, 633
BseMII	CTCAG	2 cut(s)	29, 90
BseNI	ACTGG	1 cut(s)	467
BseRI	GAGGAG	2 cut(s)	207, 317
Bsh1285I	CGRYCG	1 cut(s)	54
BshFI	GGCC	1 cut(s)	476
BsiEI	CGRYCG	1 cut(s)	54
BsiSI	CCGG	2 cut(s)	477, 608
BslI	CCNNNNNNNGG	2 cut(s)	483, 633
BsnI	GGCC	1 cut(s)	476
Bsp119I	TTCGAA	1 cut(s)	470
Bsp143I	GATC	3 cut(s)	57, 200, 418
BspACI	CCGC	5 cut(s)	44, 153, 156, 204, 257
BspANI	GGCC	1 cut(s)	476
BspCNI	CTCAG	2 cut(s)	28, 89
BspLI	GGNNCC	2 cut(s)	191, 202
BspPI	GGATC	2 cut(s)	195, 208
BspT104I	TTCGAA	1 cut(s)	470
BsrBI	CCGCTC	1 cut(s)	206
BsrI	ACTGG	1 cut(s)	467
BssECI	CCNNGG	4 cut(s)	193, 194, 378, 477
BssMI	GATC	3 cut(s)	57, 200, 418
BssNAI	GTATAC	1 cut(s)	344
BssT1I	CCWWGG	1 cut(s)	378
Bst1107I	GTATAC	1 cut(s)	344
Bst2UI	CCWGG	2 cut(s)	195, 350
Bst4CI	ACNGT	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 184
BstBI	TTCGAA	1 cut(s)	470
BstC8I	GCNNGC	1 cut(s)	605
BstDEI	CTNAG	2 cut(s)	15, 76
BstF5I	GGATG	4 cut(s)	448, 488, 535, 583
BstKTI	GATC	3 cut(s)	60, 203, 421
BstMBI	GATC	3 cut(s)	57, 200, 418
BstMCI	CGRYCG	1 cut(s)	54
BstNI	CCWGG	2 cut(s)	195, 350
BstSCI	CCNGG	4 cut(s)	193, 348, 476, 607
BstX2I	RGATCY	1 cut(s)	200
BstYI	RGATCY	1 cut(s)	200
BstZ17I	GTATAC	1 cut(s)	344
BsuRI	GGCC	1 cut(s)	476
BtsCI	GGATG	4 cut(s)	448, 488, 535, 583
Cac8I	GCNNGC	1 cut(s)	605
Csp6I	GTAC	1 cut(s)	270
CviAII	CATG	2 cut(s)	416, 436
CviJI	RGCY	7 cut(s)	19, 67, 294, 314, 370, 476, 583
CviKI_1	RGCY	7 cut(s)	19, 67, 294, 314, 370, 476, 583
CviQI	GTAC	1 cut(s)	270
DdeI	CTNAG	2 cut(s)	15, 76
DpnI	GATC	3 cut(s)	59, 202, 420
DpnII	GATC	3 cut(s)	57, 200, 418
DraI	TTTAAA	1 cut(s)	399
EciI	GGCGGA	1 cut(s)	33
Eco130I	CCWWGG	1 cut(s)	378
EcoRI	GAATTC	1 cut(s)	466
EcoRII	CCWGG	2 cut(s)	193, 348
EcoT14I	CCWWGG	1 cut(s)	378
EcoT22I	ATGCAT	1 cut(s)	448
ErhI	CCWWGG	1 cut(s)	378
FaeI	CATG	2 cut(s)	419, 439
FaiI	YATR	4 cut(s)	344, 417, 437, 495
FatI	CATG	2 cut(s)	415, 435
FbaI	TGATCA	1 cut(s)	418
FblI	GTMKAC	2 cut(s)	343, 459
Fnu4HI	GCNGC	1 cut(s)	156
FokI	GGATG	4 cut(s)	455, 495, 542, 590
Fsp4HI	GCNGC	1 cut(s)	156
FspBI	CTAG	1 cut(s)	221
GluI	GCNGC	1 cut(s)	156
HaeIII	GGCC	1 cut(s)	476
HapII	CCGG	2 cut(s)	477, 608
Hin1II	CATG	2 cut(s)	419, 439
HincII	GTYRAC	1 cut(s)	460
HindII	GTYRAC	1 cut(s)	460
HpaII	CCGG	2 cut(s)	477, 608
HphI	GGTGA	7 cut(s)	97, 103, 109, 115, 121, 127, 133
Hpy166II	GTNNAC	3 cut(s)	344, 429, 460
Hpy188I	TCNGA	1 cut(s)	51
Hpy188III	TCNNGA	1 cut(s)	422
Hpy8I	GTNNAC	3 cut(s)	344, 429, 460
HpyAV	CCTTC	4 cut(s)	241, 466, 499, 637
HpyCH4III	ACNGT	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 184
HpyCH4IV	ACGT	1 cut(s)	177
HpyCH4V	TGCA	1 cut(s)	446
HpyF3I	CTNAG	2 cut(s)	15, 76
HpySE526I	ACGT	1 cut(s)	177
Hsp92II	CATG	2 cut(s)	419, 439
Ksp22I	TGATCA	1 cut(s)	418
Kzo9I	GATC	3 cut(s)	57, 200, 418
LmnI	GCTCC	2 cut(s)	24, 259
LweI	GCATC	6 cut(s)	346, 382, 433, 455, 520, 613
MaeI	CTAG	1 cut(s)	221
MaeII	ACGT	1 cut(s)	177
MaeIII	GTNAC	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 178
MalI	GATC	3 cut(s)	59, 202, 420
MbiI	CCGCTC	1 cut(s)	206
MboI	GATC	3 cut(s)	57, 200, 418
MboII	GAAGA	3 cut(s)	340, 514, 628
MflI	RGATCY	1 cut(s)	200
MluCI	AATT	2 cut(s)	244, 466
MmeI	TCCRAC	1 cut(s)	74
Mph1103I	ATGCAT	1 cut(s)	448
MseI	TTAA	3 cut(s)	321, 398, 525
MspI	CCGG	2 cut(s)	477, 608
MspR9I	CCNGG	4 cut(s)	195, 350, 478, 609
MvaI	CCWGG	2 cut(s)	195, 350
NciI	CCSGG	2 cut(s)	478, 609
NdeII	GATC	3 cut(s)	57, 200, 418
NlaIII	CATG	2 cut(s)	419, 439
NlaIV	GGNNCC	2 cut(s)	191, 202
NmeAIII	GCCGAG	1 cut(s)	340
NmuCI	GTSAC	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 178
NsiI	ATGCAT	1 cut(s)	448
NspV	TTCGAA	1 cut(s)	470
PasI	CCCWGGG	1 cut(s)	194
PflFI	GACNNNGTC	1 cut(s)	101
PkrI	GCNGC	1 cut(s)	157
Psp6I	CCWGG	2 cut(s)	193, 348
PspGI	CCWGG	2 cut(s)	193, 348
PspN4I	GGNNCC	2 cut(s)	191, 202
PsuI	RGATCY	1 cut(s)	200
PsyI	GACNNNGTC	1 cut(s)	101
RsaI	GTAC	1 cut(s)	271
RsaNI	GTAC	1 cut(s)	270
SalI	GTCGAC	1 cut(s)	458
SaqAI	TTAA	3 cut(s)	321, 398, 525
SatI	GCNGC	1 cut(s)	156
Sau3AI	GATC	3 cut(s)	57, 200, 418
ScrFI	CCNGG	4 cut(s)	195, 350, 478, 609
SfaNI	GCATC	6 cut(s)	346, 382, 433, 455, 520, 613
SfuI	TTCGAA	1 cut(s)	470
Sse9I	AATT	2 cut(s)	244, 466
SsiI	CCGC	5 cut(s)	44, 153, 156, 204, 257
SspMI	CTAG	1 cut(s)	221
StyD4I	CCNGG	4 cut(s)	193, 348, 476, 607
StyI	CCWWGG	1 cut(s)	378
TaaI	ACNGT	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 184
TaiI	ACGT	1 cut(s)	180
TaqI	TCGA	3 cut(s)	300, 459, 470
TaqII	GACCGA	1 cut(s)	68
TasI	AATT	2 cut(s)	244, 466
TatI	WGTACW	1 cut(s)	269
TauI	GCSGC	1 cut(s)	158
Tru1I	TTAA	3 cut(s)	321, 398, 525
Tru9I	TTAA	3 cut(s)	321, 398, 525
TseFI	GTSAC	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 178
Tsp45I	GTSAC	8 cut(s)	103, 109, 115, 121, 127, 133, 139, 178
TspDTI	ATGAA	1 cut(s)	251
TspGWI	ACGGA	1 cut(s)	296
Tth111I	GACNNNGTC	1 cut(s)	101
XapI	RAATTY	1 cut(s)	466
XcmI	CCANNNNNNNNNTGG	1 cut(s)	541
XmiI	GTMKAC	2 cut(s)	343, 459
XspI	CTAG	1 cut(s)	221
Zsp2I	ATGCAT	1 cut(s)	448

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.