Rw2G024680

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Forward (+)
36454013 .. 36454210
198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G024680.1

Sequence Viewer

Length: 198 bp
ATGGCCATTTTTTCAGCTCTTCTTAGTTGCTTCATCCCTTCATCATCGTCACAGGTTTCCGATGATGTAGGAAATTCTAGTATTGCAGCTGCTTCCTCAAAGGATTCCAGAAAAATTAAGTCTTCAAAATCATCATCATCAGGAGCTCCTATAGTAGTTTCTCACTTCCCCCATAACTCATATATCTCTCGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.73

Weight (kDa)

9.51

Isoelectric Point (pI)

56.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 73
AgsI TTSAA 1 cut(s) 126
AluBI AGCT 3 cut(s) 17, 89, 146
AluI AGCT 3 cut(s) 17, 89, 146
Alw21I GWGCWC 1 cut(s) 148
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 86, 89
ApoI RAATTY 1 cut(s) 73
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 114
Bbv12I GWGCWC 1 cut(s) 148
BbvI GCAGC 2 cut(s) 76, 98
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 150
BisI GCNGC 2 cut(s) 87, 90
BlsI GCNGC 2 cut(s) 88, 91
BpiI GAAGAC 1 cut(s) 114
BseGI GGATG 1 cut(s) 33
BseXI GCAGC 2 cut(s) 76, 98
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 148
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 148
BspANI GGCC 1 cut(s) 5
BspQI GCTCTTC 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 33
BstSFI CTRYAG 1 cut(s) 150
BstV1I GCAGC 2 cut(s) 76, 98
BstV2I GAAGAC 1 cut(s) 114
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 33
CviJI RGCY 4 cut(s) 5, 17, 89, 146
CviKI_1 RGCY 4 cut(s) 5, 17, 89, 146
DdeI CTNAG 1 cut(s) 23
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Ecl136II GAGCTC 1 cut(s) 146
Eco24I GRGCYC 1 cut(s) 148
Eco53kI GAGCTC 1 cut(s) 146
EcoICRI GAGCTC 1 cut(s) 146
EcoT38I GRGCYC 1 cut(s) 148
FaiI YATR 4 cut(s) 152, 174, 181, 183
Fnu4HI GCNGC 2 cut(s) 87, 90
FokI GGATG 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 148
Fsp4HI GCNGC 2 cut(s) 87, 90
FspBI CTAG 1 cut(s) 78
GluI GCNGC 2 cut(s) 87, 90
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 108, 141
HpyAV CCTTC 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 24
LmnI GCTCC 2 cut(s) 143, 151
LpnPI CCDG 3 cut(s) 38, 121, 126
Lsp1109I GCAGC 2 cut(s) 76, 98
MaeI CTAG 1 cut(s) 78
MaeIII GTNAC 1 cut(s) 48
MboII GAAGA 2 cut(s) 11, 114
MhlI GDGCHC 1 cut(s) 148
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 73, 114
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 106
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 117
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 89
NmuCI GTSAC 1 cut(s) 48
PciSI GCTCTTC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 2 cut(s) 88, 91
Psp124BI GAGCTC 1 cut(s) 148
PvuII CAGCTG 1 cut(s) 89
SacI GAGCTC 1 cut(s) 148
SapI GCTCTTC 1 cut(s) 24
SaqAI TTAA 1 cut(s) 117
SatI GCNGC 2 cut(s) 87, 90
SduI GDGCHC 1 cut(s) 148
SetI ASST 4 cut(s) 19, 57, 91, 148
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 4 cut(s) 65, 90, 120, 153
Sse9I AATT 2 cut(s) 73, 114
SspMI CTAG 1 cut(s) 78
SstI GAGCTC 1 cut(s) 148
TasI AATT 2 cut(s) 73, 114
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TseFI GTSAC 1 cut(s) 48
TseI GCWGC 2 cut(s) 86, 89
Tsp45I GTSAC 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 22, 30
XapI RAATTY 1 cut(s) 73
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.