Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0002398

Physical Location & Seq

Genomic Coordinates Reverse (-)

52422511 .. 52423006

Gene Structure 496 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00120260.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

ATGTCCGTTTTCTCAGCTTTTCTCAACTGCTTCATGCTATCGTCACAGGTCTCGGATGATACAGCAGCAGCAGCAGCAGCAGCAGAAAACAGCAAATCCGAGAAAAGCAAATCATCATCGTCAATGGGAGCTCCCATAGTTGTTCATCATTTTCCCCTGAGTTCCTACCGTTCTTGCAAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

60

Amino Acids

6.31

Weight (kDa)

7.83

Isoelectric Point (pI)

47.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002398)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g25611
malus_domestica	MD07G1004800.v1.1
prunus_persica	Prupe.2G006100_v2.0.a1 Prupe.2G006200_v2.0.a1 Prupe.2G006300_v2.0.a1 Prupe.2G006400_v2.0.a1 Prupe.2G006700_v2.0.a1 Prupe.2G006800_v2.0.a1 Prupe.2G006900_v2.0.a1
pyrus_communis	pycom02g26560 pycom07g00370
rosa_chinensis	RchiOBHm_Chr1g0314271 RchiOBHm_Chr1g0314291 RchiOBHm_Chr2g0123781 RchiOBHm_Chr2g0123791 RchiOBHm_Chr2g0123801 RchiOBHm_Chr2g0123821 RchiOBHm_Chr2g0123871 RchiOBHm_Chr2g0123881 RchiOBHm_Chr2g0123891
rosa_laevigata	RLG00000018776
rosa_multiflora	Rmu_sc0003270.1_g000037
rosa_roxburghii	Rroxscaffold_2G00120260 Rroxscaffold_2G00120270 Rroxscaffold_2G00120290 Rroxscaffold_2G00120310 Rroxscaffold_2G00120320 Rroxscaffold_2G00120330 Rroxscaffold_2G00120340 Rroxscaffold_4G00331990
rosa_rugosa	Rorug02G0248000 Rorug02G0248200
rosa_samantha	Rh2BG315500 Rh2CG293300 Rh2DG330700
rosa_wichuraiana	Rw1G000430 Rw2G024630 Rw2G024640 Rw2G024650 Rw2G024670 Rw2G024680 Rw2G024700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	2 cut(s)	17, 131
AluI	AGCT	2 cut(s)	17, 131
Alw21I	GWGCWC	1 cut(s)	133
Alw26I	GTCTC	1 cut(s)	55
ApeKI	GCWGC	6 cut(s)	65, 68, 71, 74, 77, 80
BanII	GRGCYC	1 cut(s)	133
Bbv12I	GWGCWC	1 cut(s)	133
BbvI	GCAGC	6 cut(s)	77, 80, 83, 86, 89, 92
BcoDI	GTCTC	1 cut(s)	55
BisI	GCNGC	6 cut(s)	66, 69, 72, 75, 78, 81
BlsI	GCNGC	6 cut(s)	67, 70, 73, 76, 79, 82
BsaI	GGTCTC	1 cut(s)	55
BseGI	GGATG	1 cut(s)	61
BseMII	CTCAG	2 cut(s)	27, 149
BseXI	GCAGC	6 cut(s)	77, 80, 83, 86, 89, 92
BsiHKAI	GWGCWC	1 cut(s)	133
BsmAI	GTCTC	1 cut(s)	55
Bso31I	GGTCTC	1 cut(s)	55
Bsp1286I	GDGCHC	1 cut(s)	133
BspCNI	CTCAG	2 cut(s)	26, 150
BspTNI	GGTCTC	1 cut(s)	55
Bst4CI	ACNGT	1 cut(s)	170
BstDEI	CTNAG	2 cut(s)	13, 158
BstF5I	GGATG	1 cut(s)	61
BstMAI	GTCTC	1 cut(s)	55
BstMWI	GCNNNNNNNGC	4 cut(s)	71, 74, 77, 80
BstV1I	GCAGC	6 cut(s)	77, 80, 83, 86, 89, 92
BtsCI	GGATG	1 cut(s)	61
CviAII	CATG	1 cut(s)	34
CviJI	RGCY	2 cut(s)	17, 131
CviKI_1	RGCY	2 cut(s)	17, 131
DdeI	CTNAG	2 cut(s)	13, 158
Ecl136II	GAGCTC	1 cut(s)	131
Eco24I	GRGCYC	1 cut(s)	133
Eco31I	GGTCTC	1 cut(s)	55
Eco53kI	GAGCTC	1 cut(s)	131
EcoICRI	GAGCTC	1 cut(s)	131
EcoT38I	GRGCYC	1 cut(s)	133
FaeI	CATG	1 cut(s)	37
FaiI	YATR	2 cut(s)	35, 137
FatI	CATG	1 cut(s)	33
Fnu4HI	GCNGC	6 cut(s)	66, 69, 72, 75, 78, 81
FokI	GGATG	1 cut(s)	68
FriOI	GRGCYC	1 cut(s)	133
Fsp4HI	GCNGC	6 cut(s)	66, 69, 72, 75, 78, 81
GluI	GCNGC	6 cut(s)	66, 69, 72, 75, 78, 81
Hin1II	CATG	1 cut(s)	37
Hpy188I	TCNGA	2 cut(s)	55, 100
HpyCH4III	ACNGT	1 cut(s)	170
HpyCH4V	TGCA	1 cut(s)	177
HpyF10VI	GCNNNNNNNGC	4 cut(s)	71, 74, 77, 80
HpyF3I	CTNAG	2 cut(s)	13, 158
Hsp92II	CATG	1 cut(s)	37
LmnI	GCTCC	2 cut(s)	128, 136
LpnPI	CCDG	2 cut(s)	32, 170
Lsp1109I	GCAGC	6 cut(s)	77, 80, 83, 86, 89, 92
MaeIII	GTNAC	1 cut(s)	42
MhlI	GDGCHC	1 cut(s)	133
MwoI	GCNNNNNNNGC	4 cut(s)	71, 74, 77, 80
NlaIII	CATG	1 cut(s)	37
NmuCI	GTSAC	1 cut(s)	42
PkrI	GCNGC	6 cut(s)	67, 70, 73, 76, 79, 82
Psp124BI	GAGCTC	1 cut(s)	133
SacI	GAGCTC	1 cut(s)	133
SatI	GCNGC	6 cut(s)	66, 69, 72, 75, 78, 81
SduI	GDGCHC	1 cut(s)	133
SetI	ASST	3 cut(s)	19, 51, 133
SgeI	CNNG	5 cut(s)	46, 59, 64, 112, 169
SstI	GAGCTC	1 cut(s)	133
TaaI	ACNGT	1 cut(s)	170
TseFI	GTSAC	1 cut(s)	42
TseI	GCWGC	6 cut(s)	65, 68, 71, 74, 77, 80
Tsp45I	GTSAC	1 cut(s)	42
TspDTI	ATGAA	2 cut(s)	22, 134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.