MD07G1078400.v1.1

EF hand family protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
7544478 .. 7545272
795 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1078400.v1.1.491

Sequence Viewer

Length: 159 bp
ATGGGACAGATCCTCGACAGATTACAAGGTAAACAATGGAGGCGCAAGCAAATAAGGAGGATTACAGATAAGATGTCTGATCATTTTAAAAATGAGACAGGAAGGGCTAACTTGAATTTTGAGGATCTGTACATCGGTGTACTACTTGTGTACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.29

Weight (kDa)

10.11

Isoelectric Point (pI)

53.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 4, 132
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 3 cut(s) 131, 141, 152
AgsI TTSAA 1 cut(s) 115
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 2 cut(s) 4, 132
ApoI RAATTY 1 cut(s) 115
AspLEI GCGC 1 cut(s) 45
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 89
BslFI GGGAC 1 cut(s) 18
BsmAI GTCTC 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 18
Bsp1407I TGTACA 2 cut(s) 129, 150
Bsp143I GATC 3 cut(s) 9, 79, 124
BspPI GGATC 2 cut(s) 4, 132
BsrGI TGTACA 2 cut(s) 129, 150
BssMI GATC 3 cut(s) 9, 79, 124
BstAUI TGTACA 2 cut(s) 129, 150
BstC8I GCNNGC 1 cut(s) 47
BstHHI GCGC 1 cut(s) 45
BstKTI GATC 3 cut(s) 12, 82, 127
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 3 cut(s) 9, 79, 124
BstX2I RGATCY 2 cut(s) 9, 124
BstYI RGATCY 2 cut(s) 9, 124
Cac8I GCNNGC 1 cut(s) 47
CfoI GCGC 1 cut(s) 45
Csp6I GTAC 3 cut(s) 130, 140, 151
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
CviQI GTAC 3 cut(s) 130, 140, 151
DpnI GATC 3 cut(s) 11, 81, 126
DpnII GATC 3 cut(s) 9, 79, 124
DraI TTTAAA 1 cut(s) 88
FaqI GGGAC 1 cut(s) 18
FbaI TGATCA 1 cut(s) 79
GlaI GCGC 1 cut(s) 44
HhaI GCGC 1 cut(s) 45
Hin6I GCGC 1 cut(s) 43
HinP1I GCGC 1 cut(s) 43
Hpy166II GTNNAC 3 cut(s) 32, 140, 151
Hpy188I TCNGA 1 cut(s) 79
Hpy8I GTNNAC 3 cut(s) 32, 140, 151
HpyAV CCTTC 1 cut(s) 96
HspAI GCGC 1 cut(s) 43
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 3 cut(s) 9, 79, 124
LpnPI CCDG 1 cut(s) 84
MalI GATC 3 cut(s) 11, 81, 126
MboI GATC 3 cut(s) 9, 79, 124
MflI RGATCY 2 cut(s) 9, 124
MluCI AATT 1 cut(s) 115
MnlI CCTC 4 cut(s) 23, 33, 51, 115
MseI TTAA 1 cut(s) 87
NdeII GATC 3 cut(s) 9, 79, 124
PsuI RGATCY 2 cut(s) 9, 124
RsaI GTAC 3 cut(s) 131, 141, 152
RsaNI GTAC 3 cut(s) 130, 140, 151
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 3 cut(s) 9, 79, 124
SetI ASST 1 cut(s) 31
SgeI CNNG 5 cut(s) 26, 38, 58, 111, 124
Sse9I AATT 1 cut(s) 115
TaqI TCGA 1 cut(s) 15
TasI AATT 1 cut(s) 115
TatI WGTACW 3 cut(s) 129, 139, 150
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
XapI RAATTY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.