RchiOBHm_Chr5g0033761

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
27635361 .. 27637141
1781 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31282

Sequence Viewer

Length: 126 bp
ATGTTTGATCATTTCAAAAACAAGATAGGAAGAGCATATATGAGATTCGAGGATTGGCAAGTTTTAGACCTCTATTTCATTCTTGCCTTTTATTTCATCTTGAAGGCCTCTTTTGTTATGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

5.12

Weight (kDa)

8.12

Isoelectric Point (pI)

36.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 16, 103
AoxI GGCC 1 cut(s) 105
BclI TGATCA 1 cut(s) 7
BshFI GGCC 1 cut(s) 107
BsnI GGCC 1 cut(s) 107
Bsp143I GATC 1 cut(s) 7
BspANI GGCC 1 cut(s) 107
BspQI GCTCTTC 1 cut(s) 25
BssMI GATC 1 cut(s) 7
Bst6I CTCTTC 1 cut(s) 25
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BsuRI GGCC 1 cut(s) 107
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
Eco147I AGGCCT 1 cut(s) 107
FaiI YATR 4 cut(s) 37, 39, 41, 119
FbaI TGATCA 1 cut(s) 7
FspEI CC 7 cut(s) 12, 35, 40, 83, 89, 100, 121
HaeIII GGCC 1 cut(s) 107
HinfI GANTC 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 97
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 1 cut(s) 7
LguI GCTCTTC 1 cut(s) 25
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 1 cut(s) 42
MnlI CCTC 3 cut(s) 43, 80, 118
NdeII GATC 1 cut(s) 7
PceI AGGCCT 1 cut(s) 107
PciSI GCTCTTC 1 cut(s) 25
PfeI GAWTC 1 cut(s) 45
SapI GCTCTTC 1 cut(s) 25
Sau3AI GATC 1 cut(s) 7
SetI ASST 1 cut(s) 72
SgeI CNNG 5 cut(s) 34, 61, 71, 95, 112
SseBI AGGCCT 1 cut(s) 107
StuI AGGCCT 1 cut(s) 107
TaqI TCGA 1 cut(s) 48
TfiI GAWTC 1 cut(s) 45
TspDTI ATGAA 2 cut(s) 67, 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.