Rroxscaffold_3G00237600

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
25281986 .. 25294715
12730 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00237600.1

Sequence Viewer

Length: 150 bp
ATGTTTGATCATTTCAAAAACAAGATAGGAAGAGCATATATGAGATTCGAGGATGGGCAAGTTTTAGACCTCTTTTTCATTCTGGCCTCATTTCATTTTGAAGGCCTCTTTTGTTATGGCTTGAAGAATAGTTTCTCAACATTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.82

Weight (kDa)

6.01

Isoelectric Point (pI)

18.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 16, 101, 124
AoxI GGCC 2 cut(s) 84, 103
Asp700I GAANNNNTTC 1 cut(s) 131
BccI CCATC 1 cut(s) 47
BclI TGATCA 1 cut(s) 7
BseGI GGATG 1 cut(s) 58
BshFI GGCC 2 cut(s) 86, 105
BsnI GGCC 2 cut(s) 86, 105
Bsp143I GATC 1 cut(s) 7
BspANI GGCC 2 cut(s) 86, 105
BspQI GCTCTTC 1 cut(s) 25
BssMI GATC 1 cut(s) 7
Bst6I CTCTTC 1 cut(s) 25
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BsuRI GGCC 2 cut(s) 86, 105
BtsCI GGATG 1 cut(s) 58
CviJI RGCY 3 cut(s) 86, 105, 120
CviKI_1 RGCY 3 cut(s) 86, 105, 120
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
Eco147I AGGCCT 1 cut(s) 105
FaiI YATR 4 cut(s) 37, 39, 41, 117
FbaI TGATCA 1 cut(s) 7
FokI GGATG 1 cut(s) 65
HaeIII GGCC 2 cut(s) 86, 105
HinfI GANTC 1 cut(s) 45
HpyAV CCTTC 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 1 cut(s) 7
LguI GCTCTTC 1 cut(s) 25
LpnPI CCDG 1 cut(s) 68
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 2 cut(s) 42, 136
MnlI CCTC 4 cut(s) 43, 80, 97, 116
MroXI GAANNNNTTC 1 cut(s) 131
MseI TTAA 1 cut(s) 148
NdeII GATC 1 cut(s) 7
PceI AGGCCT 1 cut(s) 105
PciSI GCTCTTC 1 cut(s) 25
PdmI GAANNNNTTC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 45
SapI GCTCTTC 1 cut(s) 25
SaqAI TTAA 1 cut(s) 148
Sau3AI GATC 1 cut(s) 7
SetI ASST 1 cut(s) 72
SgeI CNNG 5 cut(s) 34, 61, 71, 95, 133
SseBI AGGCCT 1 cut(s) 105
StuI AGGCCT 1 cut(s) 105
TaqI TCGA 1 cut(s) 48
TfiI GAWTC 1 cut(s) 45
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
TspDTI ATGAA 2 cut(s) 67, 83
XmnI GAANNNNTTC 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.