pycom02g20340

EF hand family protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Reverse (-)
18462849 .. 18463223
375 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g20340.2

Sequence Viewer

Length: 273 bp
ATGAAGCAACCGTTAATTACATACACGTTTATAAGGTATCTGATAATTTTCTGGATTGCAGATAAGCAATGGAGGCGAAAGCAAATACGCAGGATTACAGATGAGGTGTTTGATCTTTATTTTAAAAGTGACACAGGAAGCGTTAACCTGAATTTTGAAGAACTGTACATCGGTGTACTACTTGTGTTCAATGAACTCAATAAGCGTTTACCCGGCCCGCATATTGATCCACCCTCCAAAGATATTGTCTTAGATATGATGAAGGTACTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.82

Weight (kDa)

9.0

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 32
AciI CCGC 1 cut(s) 218
AclWI GGATC 1 cut(s) 221
AcsI RAATTY 1 cut(s) 151
AfaI GTAC 3 cut(s) 167, 177, 267
AflIII ACRYGT 1 cut(s) 24
AgsI TTSAA 2 cut(s) 158, 190
AlwI GGATC 1 cut(s) 221
AoxI GGCC 1 cut(s) 214
ApoI RAATTY 1 cut(s) 151
ArsI GACNNNNNNTTYG 2 cut(s) 231, 263
AspS9I GGNCC 1 cut(s) 215
AsuC2I CCSGG 1 cut(s) 213
BcnI CCSGG 1 cut(s) 213
BfaI CTAG 1 cut(s) 271
Bme1390I CCNGG 1 cut(s) 213
BmgT120I GGNCC 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 213
BpuMI CCSGG 1 cut(s) 213
Bse3DI GCAATG 1 cut(s) 74
BseMI GCAATG 1 cut(s) 74
BshFI GGCC 1 cut(s) 216
BsiSI CCGG 1 cut(s) 213
BsnI GGCC 1 cut(s) 216
Bsp1407I TGTACA 1 cut(s) 165
Bsp143I GATC 2 cut(s) 112, 226
BspACI CCGC 1 cut(s) 218
BspANI GGCC 1 cut(s) 216
BspPI GGATC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 74
BsrGI TGTACA 1 cut(s) 165
BssMI GATC 2 cut(s) 112, 226
Bst4CI ACNGT 2 cut(s) 12, 165
BstAUI TGTACA 1 cut(s) 165
BstC8I GCNNGC 1 cut(s) 218
BstDEI CTNAG 1 cut(s) 250
BstKTI GATC 2 cut(s) 115, 229
BstMBI GATC 2 cut(s) 112, 226
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstSCI CCNGG 1 cut(s) 211
BsuRI GGCC 1 cut(s) 216
Cac8I GCNNGC 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 215
Csp6I GTAC 3 cut(s) 166, 176, 266
CviJI RGCY 1 cut(s) 216
CviKI_1 RGCY 1 cut(s) 216
CviQI GTAC 3 cut(s) 166, 176, 266
DdeI CTNAG 1 cut(s) 250
DpnI GATC 2 cut(s) 114, 228
DpnII GATC 2 cut(s) 112, 226
DraI TTTAAA 1 cut(s) 124
FaiI YATR 4 cut(s) 22, 32, 222, 257
FauI CCCGC 1 cut(s) 225
FspBI CTAG 1 cut(s) 271
HaeIII GGCC 1 cut(s) 216
HapII CCGG 1 cut(s) 213
HincII GTYRAC 1 cut(s) 145
HindII GTYRAC 1 cut(s) 145
HpaI GTTAAC 1 cut(s) 145
HpaII CCGG 1 cut(s) 213
Hpy166II GTNNAC 3 cut(s) 145, 176, 209
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 52
Hpy8I GTNNAC 3 cut(s) 145, 176, 209
HpyAV CCTTC 1 cut(s) 256
HpyCH4III ACNGT 2 cut(s) 12, 165
HpyCH4IV ACGT 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 250
HpySE526I ACGT 1 cut(s) 26
KspAI GTTAAC 1 cut(s) 145
Kzo9I GATC 2 cut(s) 112, 226
LpnPI CCDG 5 cut(s) 37, 76, 120, 161, 226
MaeI CTAG 1 cut(s) 271
MaeII ACGT 1 cut(s) 26
MaeIII GTNAC 1 cut(s) 128
MalI GATC 2 cut(s) 114, 228
MboI GATC 2 cut(s) 112, 226
MboII GAAGA 1 cut(s) 170
MluCI AATT 3 cut(s) 15, 45, 151
MnlI CCTC 3 cut(s) 66, 97, 244
MseI TTAA 3 cut(s) 14, 123, 144
MspI CCGG 1 cut(s) 213
MspR9I CCNGG 1 cut(s) 213
MwoI GCNNNNNNNGC 1 cut(s) 73
NciI CCSGG 1 cut(s) 213
NdeII GATC 2 cut(s) 112, 226
NmuCI GTSAC 1 cut(s) 128
PsiI TTATAA 1 cut(s) 32
PspPI GGNCC 1 cut(s) 215
RsaI GTAC 3 cut(s) 167, 177, 267
RsaNI GTAC 3 cut(s) 166, 176, 266
SaqAI TTAA 3 cut(s) 14, 123, 144
Sau3AI GATC 2 cut(s) 112, 226
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 213
SetI ASST 5 cut(s) 29, 38, 108, 150, 267
SgeI CNNG 9 cut(s) 37, 64, 103, 147, 160, 194, 224, 225, 229
Sse9I AATT 3 cut(s) 15, 45, 151
SsiI CCGC 1 cut(s) 218
SspMI CTAG 1 cut(s) 271
StyD4I CCNGG 1 cut(s) 211
TaaI ACNGT 2 cut(s) 12, 165
TaiI ACGT 1 cut(s) 29
TasI AATT 3 cut(s) 15, 45, 151
TatI WGTACW 2 cut(s) 165, 175
Tru1I TTAA 3 cut(s) 14, 123, 144
Tru9I TTAA 3 cut(s) 14, 123, 144
TseFI GTSAC 1 cut(s) 128
Tsp45I GTSAC 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 17, 207
XapI RAATTY 1 cut(s) 151
XspI CTAG 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.