Rroxscaffold_4G00312810

EF hand family protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
36048231 .. 36048884
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00312810.1

Sequence Viewer

Length: 225 bp
ATGAAGTGTAAGTTATATGATTGTTTCCTCCTTGTAGGTAAGCAATGGAGGCGAAAGCAAATCAAGAACATTACCGATAAGATGTTTGATCATTTCAAAAACAAGATAGGAAGAGCATATATGAGATTCGAGGATGGGCAAGTTTTAGACCTCTTTTTTATTCACGACGTGCTTTTGGGTTCATTTACGGCGTGCTTTTTGCGCGCCGTTAAATTCAAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.93

Weight (kDa)

9.76

Isoelectric Point (pI)

46.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 204
AcsI RAATTY 1 cut(s) 212
AdeI CACNNNGTG 1 cut(s) 169
AgsI TTSAA 2 cut(s) 97, 217
AjiI CACGTC 1 cut(s) 169
ApoI RAATTY 1 cut(s) 212
AspLEI GCGC 2 cut(s) 204, 206
BccI CCATC 1 cut(s) 128
BceAI ACGGC 2 cut(s) 191, 204
BclI TGATCA 1 cut(s) 88
BmgBI CACGTC 1 cut(s) 169
Bse3DI GCAATG 1 cut(s) 50
BseGI GGATG 1 cut(s) 139
BseMI GCAATG 1 cut(s) 50
BsePI GCGCGC 1 cut(s) 202
Bsh1236I CGCG 1 cut(s) 204
Bsp143I GATC 1 cut(s) 88
BspFNI CGCG 1 cut(s) 204
BspQI GCTCTTC 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 50
BssHII GCGCGC 1 cut(s) 202
BssMI GATC 1 cut(s) 88
Bst6I CTCTTC 1 cut(s) 106
BstC8I GCNNGC 2 cut(s) 193, 204
BstF5I GGATG 1 cut(s) 139
BstFNI CGCG 1 cut(s) 204
BstHHI GCGC 2 cut(s) 204, 206
BstKTI GATC 1 cut(s) 91
BstMBI GATC 1 cut(s) 88
BstMWI GCNNNNNNNGC 2 cut(s) 49, 201
BstUI CGCG 1 cut(s) 204
BtrI CACGTC 1 cut(s) 169
BtsCI GGATG 1 cut(s) 139
Cac8I GCNNGC 2 cut(s) 193, 204
CfoI GCGC 2 cut(s) 204, 206
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
DraIII CACNNNGTG 1 cut(s) 169
Eam1104I CTCTTC 1 cut(s) 106
EarI CTCTTC 1 cut(s) 106
FaiI YATR 5 cut(s) 16, 18, 118, 120, 122
FbaI TGATCA 1 cut(s) 88
FokI GGATG 1 cut(s) 146
GlaI GCGC 2 cut(s) 203, 205
HhaI GCGC 2 cut(s) 204, 206
Hin6I GCGC 2 cut(s) 202, 204
HinP1I GCGC 2 cut(s) 202, 204
HinfI GANTC 1 cut(s) 126
Hpy188III TCNNGA 2 cut(s) 64, 164
Hpy99I CGWCG 1 cut(s) 170
HpyCH4IV ACGT 1 cut(s) 168
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 201
HpySE526I ACGT 1 cut(s) 168
HspAI GCGC 2 cut(s) 202, 204
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 1 cut(s) 88
LguI GCTCTTC 1 cut(s) 106
MaeII ACGT 1 cut(s) 168
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 1 cut(s) 123
MluCI AATT 2 cut(s) 212, 220
MnlI CCTC 4 cut(s) 38, 42, 124, 161
MseI TTAA 1 cut(s) 210
MvnI CGCG 1 cut(s) 204
MwoI GCNNNNNNNGC 2 cut(s) 49, 201
NdeII GATC 1 cut(s) 88
PauI GCGCGC 1 cut(s) 202
PciSI GCTCTTC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 126
PteI GCGCGC 1 cut(s) 202
SapI GCTCTTC 1 cut(s) 106
SaqAI TTAA 1 cut(s) 210
Sau3AI GATC 1 cut(s) 88
SetI ASST 3 cut(s) 40, 153, 171
SgeI CNNG 9 cut(s) 44, 76, 115, 142, 152, 176, 181, 204, 215
Sse9I AATT 2 cut(s) 212, 220
TaiI ACGT 1 cut(s) 171
TaqI TCGA 1 cut(s) 129
TasI AATT 2 cut(s) 212, 220
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TspDTI ATGAA 2 cut(s) 17, 171
XapI RAATTY 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.