Rh4BG205300

EF hand family protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
35267784 .. 35272228
4445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG205300.1

Sequence Viewer

Length: 204 bp
ATGGATGAAGAAGTAGGTAGAATCTTCTACAATGGTAAGCAATGGAGGCGAAAGCAAATCAAGAACATTACCGATAAGATGTTTGATCATTTCAAAAACAAGATAGGAAGAGCATATATGAGATTCGAGGATGGGCAAGTTTTAGACCTCTTTTTTGTTCTTGCCTCTCATTTCATTTTGAAGGCCTTTTGTGTTATGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

8.09

Weight (kDa)

9.52

Isoelectric Point (pI)

47.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 94, 181
AoxI GGCC 1 cut(s) 183
ArsI GACNNNNNNTTYG 2 cut(s) 137, 169
BccI CCATC 1 cut(s) 125
BclI TGATCA 1 cut(s) 85
Bse3DI GCAATG 1 cut(s) 47
BseGI GGATG 2 cut(s) 10, 136
BseMI GCAATG 1 cut(s) 47
BshFI GGCC 1 cut(s) 185
BsnI GGCC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 85
BspANI GGCC 1 cut(s) 185
BspQI GCTCTTC 1 cut(s) 103
BsrDI GCAATG 1 cut(s) 47
BssMI GATC 1 cut(s) 85
Bst6I CTCTTC 1 cut(s) 103
BstF5I GGATG 2 cut(s) 10, 136
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstMWI GCNNNNNNNGC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 185
BtsCI GGATG 2 cut(s) 10, 136
CviJI RGCY 2 cut(s) 185, 200
CviKI_1 RGCY 2 cut(s) 185, 200
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 103
EarI CTCTTC 1 cut(s) 103
Eco147I AGGCCT 1 cut(s) 185
FaiI YATR 4 cut(s) 115, 117, 119, 197
FbaI TGATCA 1 cut(s) 85
FokI GGATG 2 cut(s) 17, 143
HaeIII GGCC 1 cut(s) 185
HinfI GANTC 2 cut(s) 21, 123
Hpy188III TCNNGA 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
Ksp22I TGATCA 1 cut(s) 85
Kzo9I GATC 1 cut(s) 85
LguI GCTCTTC 1 cut(s) 103
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 3 cut(s) 16, 20, 120
MnlI CCTC 4 cut(s) 39, 121, 158, 175
MwoI GCNNNNNNNGC 1 cut(s) 46
NdeII GATC 1 cut(s) 85
PceI AGGCCT 1 cut(s) 185
PciSI GCTCTTC 1 cut(s) 103
PfeI GAWTC 2 cut(s) 21, 123
SapI GCTCTTC 1 cut(s) 103
Sau3AI GATC 1 cut(s) 85
SetI ASST 2 cut(s) 19, 150
SgeI CNNG 5 cut(s) 73, 112, 139, 149, 173
SseBI AGGCCT 1 cut(s) 185
StuI AGGCCT 1 cut(s) 185
TaqI TCGA 1 cut(s) 126
TfiI GAWTC 2 cut(s) 21, 123
TspDTI ATGAA 2 cut(s) 21, 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.