MD09G1079900.v1.1

S-adenosyl-l-methionine decarboxylase leader peptide

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
5603353 .. 5604730
1378 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1079900.v1.1.491

Sequence Viewer

Length: 156 bp
ATGGAGTCCAAAGGTGGCAAAAAGGATTCTAGTAGTAGTAAATCATTGTTCTACGAAGCTCCCCTCGGTTACAGCATTGAAGACGTCAGGCCTCACGGTGGAATCAAGAAATTCAGATCAGCTGCTTACTCTAACTGCGCTCGGAAGCCCTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.55

Weight (kDa)

9.67

Isoelectric Point (pI)

58.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AdoMetDC_leader PF08132 1 - 51 1.8e-34 S-adenosyl-l-methionine decarboxylase leader peptide
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 87
AcsI RAATTY 1 cut(s) 110
AcyI GRCGYC 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 98
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 2 cut(s) 59, 122
AluI AGCT 2 cut(s) 59, 122
AoxI GGCC 1 cut(s) 89
ApeKI GCWGC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 110
AspLEI GCGC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 87
BbvI GCAGC 1 cut(s) 109
BfaI CTAG 1 cut(s) 30
BisI GCNGC 1 cut(s) 123
BlsI GCNGC 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 87
BsaHI GRCGYC 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseDI CCNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 98
BseXI GCAGC 1 cut(s) 109
BshFI GGCC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 98
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 116
BspANI GGCC 1 cut(s) 91
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 1 cut(s) 116
BssNI GRCGYC 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 98
BstACI GRCGYC 1 cut(s) 84
BstHHI GCGC 1 cut(s) 140
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstV1I GCAGC 1 cut(s) 109
BstV2I GAAGAC 1 cut(s) 87
BsuRI GGCC 1 cut(s) 91
CfoI GCGC 1 cut(s) 140
CviJI RGCY 4 cut(s) 59, 91, 122, 148
CviKI_1 RGCY 4 cut(s) 59, 91, 122, 148
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Eco147I AGGCCT 1 cut(s) 91
Fnu4HI GCNGC 1 cut(s) 123
Fsp4HI GCNGC 1 cut(s) 123
FspBI CTAG 1 cut(s) 30
GlaI GCGC 1 cut(s) 139
GluI GCNGC 1 cut(s) 123
HaeIII GGCC 1 cut(s) 91
HhaI GCGC 1 cut(s) 140
Hin1I GRCGYC 1 cut(s) 84
Hin6I GCGC 1 cut(s) 138
HinP1I GCGC 1 cut(s) 138
HinfI GANTC 3 cut(s) 5, 26, 102
Hpy188I TCNGA 2 cut(s) 116, 144
Hpy188III TCNNGA 2 cut(s) 106, 153
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 84
Hsp92I GRCGYC 1 cut(s) 84
HspAI GCGC 1 cut(s) 138
Kzo9I GATC 1 cut(s) 116
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 73
Lsp1109I GCAGC 1 cut(s) 109
MaeI CTAG 1 cut(s) 30
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 68
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 92
MluCI AATT 1 cut(s) 110
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 2 cut(s) 74, 102
MspA1I CMGCKG 1 cut(s) 122
NdeII GATC 1 cut(s) 116
PceI AGGCCT 1 cut(s) 91
PfeI GAWTC 2 cut(s) 26, 102
PkrI GCNGC 1 cut(s) 124
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PvuII CAGCTG 1 cut(s) 122
SatI GCNGC 1 cut(s) 123
Sau3AI GATC 1 cut(s) 116
SchI GAGTC 1 cut(s) 14
SetI ASST 4 cut(s) 16, 61, 87, 124
SgeI CNNG 5 cut(s) 42, 77, 100, 107, 118
Sse9I AATT 1 cut(s) 110
SseBI AGGCCT 1 cut(s) 91
SspMI CTAG 1 cut(s) 30
StuI AGGCCT 1 cut(s) 91
TaaI ACNGT 1 cut(s) 98
TaiI ACGT 1 cut(s) 87
TasI AATT 1 cut(s) 110
TfiI GAWTC 2 cut(s) 26, 102
TseI GCWGC 1 cut(s) 122
XapI RAATTY 1 cut(s) 110
XspI CTAG 1 cut(s) 30
ZraI GACGTC 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.