Prupe.1G299600_v2.0.a1

S-adenosyl-l-methionine decarboxylase leader peptide

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
29463337 .. 29463612
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G299600.1

Sequence Viewer

Length: 156 bp
ATGGAGTCTAAAGGTGGTAAAAAGAATTCTAGTAGTAGTAAATCCTTATTCTATGAAGCACCTCTTGGATACAGCATCGAAGACATCCGACCCAACGGTGGAATCAAGAAGTTCAGATCTGCTGCTTACTCCAACTGCGCTCGCAAACCATCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.54

Weight (kDa)

9.84

Isoelectric Point (pI)

53.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 98
AjuI GAANNNNNNNTTGG 2 cut(s) 48, 80
ApeKI GCWGC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 25
AspLEI GCGC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 87
BbvI GCAGC 1 cut(s) 109
BciVI GTATCC 1 cut(s) 62
BfaI CTAG 1 cut(s) 30
BfuI GTATCC 1 cut(s) 62
BglII AGATCT 1 cut(s) 116
BisI GCNGC 1 cut(s) 123
BlsI GCNGC 1 cut(s) 124
BmsI GCATC 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 87
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseGI GGATG 2 cut(s) 84, 149
BseLI CCNNNNNNNGG 1 cut(s) 98
BseXI GCAGC 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 98
Bsp143I GATC 1 cut(s) 116
BssMI GATC 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 142
BstF5I GGATG 2 cut(s) 84, 149
BstHHI GCGC 1 cut(s) 140
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstV1I GCAGC 1 cut(s) 109
BstV2I GAAGAC 1 cut(s) 87
BstX2I RGATCY 1 cut(s) 116
BstYI RGATCY 1 cut(s) 116
BsuI GTATCC 1 cut(s) 62
BtsCI GGATG 2 cut(s) 84, 149
Cac8I GCNNGC 1 cut(s) 142
CfoI GCGC 1 cut(s) 140
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
EcoRI GAATTC 1 cut(s) 25
FaiI YATR 1 cut(s) 54
FalI AAGNNNNNCTT 2 cut(s) 48, 80
Fnu4HI GCNGC 1 cut(s) 123
FokI GGATG 2 cut(s) 71, 136
Fsp4HI GCNGC 1 cut(s) 123
FspBI CTAG 1 cut(s) 30
FspEI CC 9 cut(s) 51, 58, 75, 81, 84, 101, 105, 106, 145
GlaI GCGC 1 cut(s) 139
GluI GCNGC 1 cut(s) 123
HhaI GCGC 1 cut(s) 140
Hin6I GCGC 1 cut(s) 138
HinP1I GCGC 1 cut(s) 138
HinfI GANTC 2 cut(s) 5, 102
Hpy188I TCNGA 2 cut(s) 89, 116
Hpy188III TCNNGA 2 cut(s) 106, 153
HpyCH4III ACNGT 1 cut(s) 98
HspAI GCGC 1 cut(s) 138
Kzo9I GATC 1 cut(s) 116
Lsp1109I GCAGC 1 cut(s) 109
LweI GCATC 1 cut(s) 84
MaeI CTAG 1 cut(s) 30
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 92
MflI RGATCY 1 cut(s) 116
MluCI AATT 1 cut(s) 25
MlyI GAGTC 1 cut(s) 14
MmeI TCCRAC 2 cut(s) 112, 156
MnlI CCTC 1 cut(s) 72
NdeII GATC 1 cut(s) 116
PfeI GAWTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 124
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PsuI RGATCY 1 cut(s) 116
SatI GCNGC 1 cut(s) 123
Sau3AI GATC 1 cut(s) 116
SchI GAGTC 1 cut(s) 14
SetI ASST 2 cut(s) 16, 64
SfaNI GCATC 1 cut(s) 84
SgeI CNNG 3 cut(s) 42, 77, 118
Sse9I AATT 1 cut(s) 25
SspMI CTAG 1 cut(s) 30
TaaI ACNGT 1 cut(s) 98
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 25
TfiI GAWTC 1 cut(s) 102
TseI GCWGC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 69
XapI RAATTY 1 cut(s) 25
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.