Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr09

Orthogroup ID

OG0003650

Physical Location & Seq

Genomic Coordinates Reverse (-)

20941833 .. 20942231

Gene Structure 399 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD09G1213300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

ATGAATCGAAATGCAATGGTGTTTTCCCAAGTTATAGAGAGGGCTAATTCTCTAATTTCTAGGCTTGAAGATGAGAAAGATGTGGTTTACATTTCCTTAACAGAGCATAAGATTGCGTCCAAAGAGGCCCAAGAAAACATGGAAGATGTCCATAATCTTGTCATGAGACTAGGCGAGGAAAGGAAGGGTCTGGAGAAGAGAAGCAAAAAATTGGAAGAGGAATTGGTATCTGCTAAGGGTGAAATATTACGGCTAAGAAGTCAAATAAATTCATCAAAAGATCTCGTAAATAATCAGCAACCACCAGAAGAGGCTGAAGAGCCTGTTGTGGATACAAATTTCTTCCTCCTTGATCTTGGACAAAATTGCACCTACAAAACAATTAACACCTTTGGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0009295 GO:0009507 GO:0009532 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0016020 GO:0016363 GO:0031974 GO:0031976 GO:0031981 GO:0031984 GO:0034357 GO:0034399 GO:0042646 GO:0042651 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035 GO:0070013 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

133

Amino Acids

15.15

Weight (kDa)

5.05

Isoelectric Point (pI)

56.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003650)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G16000
fragaria_vesca	FvH4_6g31081 FvH4_6g31081 FvH4_6g31081 FvH4_6g31081 FvH4_6g31081 FvH4_6g31081 FvH4_6g31081 FvH4_6g31081 FvH4_6g31081
malus_domestica	MD09G1212900.v1.1 MD09G1213300.v1.1 MD09G1213400.v1.1 MD09G1213500.v1.1 MD09G1213800.v1.1 MD17G1195700.v1.1
prunus_persica	Prupe.3G071700_v2.0.a1
pyrus_communis	pycom09g13050 pycom17g20130 pycom17g20140
rosa_chinensis	RchiOBHm_Chr2g0137781
rosa_laevigata	RLG00000019675
rosa_multiflora	Rmu_sc0008635.1_g000002
rosa_roxburghii	Rroxscaffold_2G00106850
rosa_rugosa	Rorug02G0345400 Rorug02G0345500 Rorug02G0345600 Rorug02G0345600 Rorug02G0345700 Rorug02G0345700
rosa_samantha	Rh2AG392700 Rh2BG400400 Rh2CG379400 Rh2DG415300
rosa_wichuraiana	Rw2G032170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	268, 337
AcuI	CTGAAG	1 cut(s)	336
AgsI	TTSAA	1 cut(s)	68
Alw26I	GTCTC	1 cut(s)	160
AoxI	GGCC	1 cut(s)	126
ApoI	RAATTY	2 cut(s)	268, 337
AspS9I	GGNCC	1 cut(s)	127
AsuHPI	GGTGA	1 cut(s)	251
BceAI	ACGGC	1 cut(s)	266
BciVI	GTATCC	1 cut(s)	325
BcoDI	GTCTC	1 cut(s)	160
BfaI	CTAG	2 cut(s)	60, 170
BfuI	GTATCC	1 cut(s)	325
BglII	AGATCT	1 cut(s)	280
BmgT120I	GGNCC	1 cut(s)	127
BpmI	CTGGAG	1 cut(s)	212
Bpu10I	CCTNAGC	1 cut(s)	234
Bse3DI	GCAATG	1 cut(s)	21
BseMI	GCAATG	1 cut(s)	21
BshFI	GGCC	1 cut(s)	128
BsmAI	GTCTC	1 cut(s)	160
BsnI	GGCC	1 cut(s)	128
Bsp143I	GATC	2 cut(s)	280, 352
BspANI	GGCC	1 cut(s)	128
BspHI	TCATGA	1 cut(s)	162
BspQI	GCTCTTC	1 cut(s)	312
BsrDI	GCAATG	1 cut(s)	21
BssMI	GATC	2 cut(s)	280, 352
Bst6I	CTCTTC	4 cut(s)	191, 210, 303, 312
BstDEI	CTNAG	2 cut(s)	234, 254
BstKTI	GATC	2 cut(s)	283, 355
BstMAI	GTCTC	1 cut(s)	160
BstMBI	GATC	2 cut(s)	280, 352
BstX2I	RGATCY	1 cut(s)	280
BstYI	RGATCY	1 cut(s)	280
BsuI	GTATCC	1 cut(s)	325
BsuRI	GGCC	1 cut(s)	128
CciI	TCATGA	1 cut(s)	162
Cfr13I	GGNCC	1 cut(s)	127
CseI	GACGC	1 cut(s)	105
CviAII	CATG	2 cut(s)	139, 163
CviJI	RGCY	6 cut(s)	44, 64, 128, 253, 314, 322
CviKI_1	RGCY	6 cut(s)	44, 64, 128, 253, 314, 322
DdeI	CTNAG	2 cut(s)	234, 254
DpnI	GATC	2 cut(s)	282, 354
DpnII	GATC	2 cut(s)	280, 352
Eam1104I	CTCTTC	4 cut(s)	191, 210, 303, 312
EarI	CTCTTC	4 cut(s)	191, 210, 303, 312
Eco57I	CTGAAG	1 cut(s)	336
FaeI	CATG	2 cut(s)	142, 166
FaiI	YATR	5 cut(s)	35, 108, 140, 153, 164
FatI	CATG	2 cut(s)	138, 162
FspBI	CTAG	2 cut(s)	60, 170
GsuI	CTGGAG	1 cut(s)	212
HaeIII	GGCC	1 cut(s)	128
HgaI	GACGC	1 cut(s)	105
Hin1II	CATG	2 cut(s)	142, 166
HinfI	GANTC	1 cut(s)	4
HphI	GGTGA	1 cut(s)	251
Hpy166II	GTNNAC	1 cut(s)	88
Hpy188III	TCNNGA	2 cut(s)	163, 191
Hpy8I	GTNNAC	1 cut(s)	88
HpyAV	CCTTC	1 cut(s)	178
HpyCH4V	TGCA	2 cut(s)	14, 369
HpyF3I	CTNAG	2 cut(s)	234, 254
Hsp92II	CATG	2 cut(s)	142, 166
Kzo9I	GATC	2 cut(s)	280, 352
LguI	GCTCTTC	1 cut(s)	312
LpnPI	CCDG	3 cut(s)	176, 318, 336
MaeI	CTAG	2 cut(s)	60, 170
MalI	GATC	2 cut(s)	282, 354
MboI	GATC	2 cut(s)	280, 352
MboII	GAAGA	7 cut(s)	80, 155, 208, 227, 320, 329, 334
MflI	RGATCY	1 cut(s)	280
MluCI	AATT	8 cut(s)	46, 54, 209, 221, 268, 337, 364, 381
MnlI	CCTC	6 cut(s)	33, 118, 169, 211, 304, 356
MseI	TTAA	3 cut(s)	98, 384, 397
NdeII	GATC	2 cut(s)	280, 352
NlaIII	CATG	2 cut(s)	142, 166
PagI	TCATGA	1 cut(s)	162
PciSI	GCTCTTC	1 cut(s)	312
PfeI	GAWTC	1 cut(s)	4
PspPI	GGNCC	1 cut(s)	127
PsuI	RGATCY	1 cut(s)	280
SapI	GCTCTTC	1 cut(s)	312
SaqAI	TTAA	3 cut(s)	98, 384, 397
Sau3AI	GATC	2 cut(s)	280, 352
Sau96I	GGNCC	1 cut(s)	127
SetI	ASST	2 cut(s)	374, 392
Sse9I	AATT	8 cut(s)	46, 54, 209, 221, 268, 337, 364, 381
SspI	AATATT	1 cut(s)	246
SspMI	CTAG	2 cut(s)	60, 170
TaqI	TCGA	1 cut(s)	7
TasI	AATT	8 cut(s)	46, 54, 209, 221, 268, 337, 364, 381
TfiI	GAWTC	1 cut(s)	4
Tru1I	TTAA	3 cut(s)	98, 384, 397
Tru9I	TTAA	3 cut(s)	98, 384, 397
TspDTI	ATGAA	2 cut(s)	17, 261
XapI	RAATTY	2 cut(s)	268, 337
XspI	CTAG	2 cut(s)	60, 170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.