MD10G1044000.v1.1
TCP Family

1-phosphatidylinositol-3-phosphate 5-kinase FAB1D

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
5903812 .. 5904299
488 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1044000.v1.1.491

Sequence Viewer

Length: 234 bp
ATGGATGTCAGCAATCAATCTAATGGCAGACTACAGAATTCAAGCTTTGAGCATCCAGTAAATGGTCTTGATAACATGTATACAGTAAGAGATGTTGAGATTATACAGACAAGTGATGTTCATGAAGCAAAAGATAGTAACGAAAATGAAGATTCAAATTATTTAGAAGAATACAAATGCTGGGTATGGGAACCCCCTGAACCTCATGATCTAGAGGTTGATGGTGAGGAATGA

Protein Analysis

78

Amino Acids

8.96

Weight (kDa)

4.09

Isoelectric Point (pI)

47.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 62
AccI GTMKAC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 62
AflIII ACRYGT 1 cut(s) 75
AgsI TTSAA 2 cut(s) 42, 156
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
ApoI RAATTY 1 cut(s) 37
BccI CCATC 1 cut(s) 215
BfaI CTAG 1 cut(s) 212
BfmI CTRYAG 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 192
BmsI GCATC 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse1I ACTGG 1 cut(s) 56
BseGI GGATG 2 cut(s) 10, 52
BseLI CCNNNNNNNGG 1 cut(s) 62
BseNI ACTGG 1 cut(s) 56
BseYI CCCAGC 1 cut(s) 180
BslI CCNNNNNNNGG 1 cut(s) 62
Bsp143I GATC 1 cut(s) 208
BspHI TCATGA 2 cut(s) 121, 205
BspLI GGNNCC 1 cut(s) 192
BsrI ACTGG 1 cut(s) 56
BssMI GATC 1 cut(s) 208
BssNAI GTATAC 1 cut(s) 81
Bst1107I GTATAC 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 85
BstF5I GGATG 2 cut(s) 10, 52
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstNSI RCATGY 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 32
BstZ17I GTATAC 1 cut(s) 81
BtsCI GGATG 2 cut(s) 10, 52
CciI TCATGA 2 cut(s) 121, 205
CviAII CATG 3 cut(s) 76, 122, 206
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
EcoRI GAATTC 1 cut(s) 37
FaeI CATG 3 cut(s) 79, 125, 209
FaiI YATR 6 cut(s) 77, 81, 104, 123, 187, 207
FatI CATG 3 cut(s) 75, 121, 205
FblI GTMKAC 1 cut(s) 80
FokI GGATG 2 cut(s) 17, 39
FspBI CTAG 1 cut(s) 212
GsaI CCCAGC 1 cut(s) 184
Hin1II CATG 3 cut(s) 79, 125, 209
HindIII AAGCTT 1 cut(s) 43
HinfI GANTC 1 cut(s) 152
Hpy166II GTNNAC 1 cut(s) 81
Hpy188III TCNNGA 4 cut(s) 68, 122, 206, 212
Hpy8I GTNNAC 1 cut(s) 81
HpyCH4III ACNGT 1 cut(s) 85
Hsp92II CATG 3 cut(s) 79, 125, 209
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 3 cut(s) 69, 166, 210
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 137
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 2 cut(s) 161, 179
MluCI AATT 2 cut(s) 37, 157
MnlI CCTC 3 cut(s) 208, 213, 220
NdeII GATC 1 cut(s) 208
NlaIII CATG 3 cut(s) 79, 125, 209
NlaIV GGNNCC 1 cut(s) 192
NspI RCATGY 1 cut(s) 79
PagI TCATGA 2 cut(s) 121, 205
PciI ACATGT 1 cut(s) 75
PfeI GAWTC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 62
PscI ACATGT 1 cut(s) 75
PspFI CCCAGC 1 cut(s) 180
PspN4I GGNNCC 1 cut(s) 192
Sau3AI GATC 1 cut(s) 208
SetI ASST 3 cut(s) 47, 205, 219
SfaNI GCATC 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 32
Sse9I AATT 2 cut(s) 37, 157
SspMI CTAG 1 cut(s) 212
TaaI ACNGT 1 cut(s) 85
TasI AATT 2 cut(s) 37, 157
TfiI GAWTC 1 cut(s) 152
TspDTI ATGAA 3 cut(s) 110, 138, 162
Van91I CCANNNNNTGG 1 cut(s) 62
XapI RAATTY 1 cut(s) 37
XbaI TCTAGA 1 cut(s) 211
XceI RCATGY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 80
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.