Rmu_sc0014453.1_g000001
TCP Family

1-phosphatidylinositol-3-phosphate 5-kinase FAB1D

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014453.1
Physical Location & Seq
Reverse (-)
2 .. 647
646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014453.1_g000001.1.cds

Sequence Viewer

Length: 405 bp
atgtatagtatgtgtcagtactgtggtgcagaattgacacaacctaaagatgaaaagaaggaacatgataatctgaaaaccttaccgtcagatagggcttgcaaagcttgtgcagaaaaacaggagagaggatctaccaagcaggccaatggaatgtcaaggccaacgatcagtccaatgacttccttgtcaagcagtgatagttctgtctccaactgcagtgaattttctgttgatgtcaactcatatgatcgtacggcaggcacgaataatgaccagctatgggaacccccatctgcaaacacttgtggatcatctagcgaagctgagaattcaaattcttcagaaggtgaaatggctgactggatatgggatcctcctgaacctgatgatccggaggacgat

Protein Analysis

135

Amino Acids

14.76

Weight (kDa)

4.23

Isoelectric Point (pI)

54.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 187
AccIII TCCGGA 1 cut(s) 394
AclWI GGATC 5 cut(s) 139, 319, 368, 381, 386
AcsI RAATTY 3 cut(s) 224, 331, 337
AcuI CTGAAG 1 cut(s) 327
AfaI GTAC 2 cut(s) 20, 256
AfiI CCNNNNNNNGG 1 cut(s) 283
AgsI TTSAA 1 cut(s) 336
AluBI AGCT 3 cut(s) 107, 280, 326
AluI AGCT 3 cut(s) 107, 280, 326
Alw26I GTCTC 1 cut(s) 214
AlwI GGATC 5 cut(s) 139, 319, 368, 381, 386
Aor13HI TCCGGA 1 cut(s) 394
AoxI GGCC 2 cut(s) 144, 161
ApoI RAATTY 3 cut(s) 224, 331, 337
AsuHPI GGTGA 1 cut(s) 362
BamHI GGATCC 1 cut(s) 373
BccI CCATC 1 cut(s) 301
BceAI ACGGC 1 cut(s) 273
BcoDI GTCTC 1 cut(s) 214
BfaI CTAG 1 cut(s) 318
BfmI CTRYAG 1 cut(s) 217
BmcAI AGTACT 1 cut(s) 20
BmiI GGNNCC 2 cut(s) 288, 375
BsaWI WCCGGW 1 cut(s) 394
Bsc4I CCNNNNNNNGG 1 cut(s) 283
Bse1I ACTGG 1 cut(s) 368
BseAI TCCGGA 1 cut(s) 394
BseLI CCNNNNNNNGG 1 cut(s) 283
BseMII CTCAG 1 cut(s) 318
BseNI ACTGG 1 cut(s) 368
BsgI GTGCAG 2 cut(s) 48, 132
BshFI GGCC 2 cut(s) 146, 163
BsiSI CCGG 1 cut(s) 395
BsiWI CGTACG 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 283
BsmAI GTCTC 1 cut(s) 214
BsnI GGCC 2 cut(s) 146, 163
Bsp13I TCCGGA 1 cut(s) 394
Bsp143I GATC 6 cut(s) 131, 168, 250, 311, 373, 391
BspANI GGCC 2 cut(s) 146, 163
BspCNI CTCAG 1 cut(s) 319
BspEI TCCGGA 1 cut(s) 394
BspLI GGNNCC 2 cut(s) 288, 375
BspMAI CTGCAG 1 cut(s) 221
BspPI GGATC 5 cut(s) 139, 319, 368, 381, 386
BsrI ACTGG 1 cut(s) 368
BssMI GATC 6 cut(s) 131, 168, 250, 311, 373, 391
Bst4CI ACNGT 2 cut(s) 23, 87
BstC8I GCNNGC 3 cut(s) 100, 144, 262
BstDEI CTNAG 1 cut(s) 327
BstKTI GATC 6 cut(s) 134, 171, 253, 314, 376, 394
BstMAI GTCTC 1 cut(s) 214
BstMBI GATC 6 cut(s) 131, 168, 250, 311, 373, 391
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 217
BstX2I RGATCY 2 cut(s) 131, 373
BstYI RGATCY 2 cut(s) 131, 373
BsuRI GGCC 2 cut(s) 146, 163
BtsI GCAGTG 2 cut(s) 202, 226
BtsIMutI CAGTG 2 cut(s) 202, 226
Cac8I GCNNGC 3 cut(s) 100, 144, 262
Csp6I GTAC 2 cut(s) 19, 255
CviAII CATG 1 cut(s) 65
CviJI RGCY 7 cut(s) 98, 107, 146, 163, 280, 326, 359
CviKI_1 RGCY 7 cut(s) 98, 107, 146, 163, 280, 326, 359
CviQI GTAC 2 cut(s) 19, 255
DdeI CTNAG 1 cut(s) 327
DpnI GATC 6 cut(s) 133, 170, 252, 313, 375, 393
DpnII GATC 6 cut(s) 131, 168, 250, 311, 373, 391
DrdI GACNNNNNNGTC 1 cut(s) 187
DseDI GACNNNNNNGTC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 327
EcoRI GAATTC 1 cut(s) 331
FaeI CATG 1 cut(s) 68
FaiI YATR 7 cut(s) 6, 11, 66, 247, 249, 283, 370
FatI CATG 1 cut(s) 64
FauNDI CATATG 1 cut(s) 247
FspBI CTAG 1 cut(s) 318
HaeIII GGCC 2 cut(s) 146, 163
HapII CCGG 1 cut(s) 395
Hin1II CATG 1 cut(s) 68
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HindIII AAGCTT 1 cut(s) 105
HpaII CCGG 1 cut(s) 395
HphI GGTGA 1 cut(s) 362
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 3 cut(s) 75, 91, 346
Hpy188III TCNNGA 2 cut(s) 380, 395
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 2 cut(s) 52, 341
HpyCH4III ACNGT 2 cut(s) 23, 87
HpyCH4V TGCA 5 cut(s) 29, 102, 113, 219, 299
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 327
Hsp92II CATG 1 cut(s) 68
Kpn2I TCCGGA 1 cut(s) 394
Kzo9I GATC 6 cut(s) 131, 168, 250, 311, 373, 391
LpnPI CCDG 7 cut(s) 107, 128, 246, 290, 349, 393, 399
MaeI CTAG 1 cut(s) 318
MalI GATC 6 cut(s) 133, 170, 252, 313, 375, 393
MboI GATC 6 cut(s) 131, 168, 250, 311, 373, 391
MboII GAAGA 1 cut(s) 333
MflI RGATCY 2 cut(s) 131, 373
MluCI AATT 4 cut(s) 32, 224, 331, 337
MmeI TCCRAC 1 cut(s) 237
MnlI CCTC 3 cut(s) 122, 387, 391
MroI TCCGGA 1 cut(s) 394
MspI CCGG 1 cut(s) 395
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeI CATATG 1 cut(s) 247
NdeII GATC 6 cut(s) 131, 168, 250, 311, 373, 391
NlaIII CATG 1 cut(s) 68
NlaIV GGNNCC 2 cut(s) 288, 375
PcsI WCGNNNNNNNCGW 1 cut(s) 263
Pfl23II CGTACG 1 cut(s) 254
PspLI CGTACG 1 cut(s) 254
PspN4I GGNNCC 2 cut(s) 288, 375
PstI CTGCAG 1 cut(s) 221
PsuI RGATCY 2 cut(s) 131, 373
RsaI GTAC 2 cut(s) 20, 256
RsaNI GTAC 2 cut(s) 19, 255
Sau3AI GATC 6 cut(s) 131, 168, 250, 311, 373, 391
ScaI AGTACT 1 cut(s) 20
SetI ASST 7 cut(s) 46, 83, 109, 282, 328, 352, 388
SfcI CTRYAG 1 cut(s) 217
Sse9I AATT 4 cut(s) 32, 224, 331, 337
SspMI CTAG 1 cut(s) 318
TaaI ACNGT 2 cut(s) 23, 87
TasI AATT 4 cut(s) 32, 224, 331, 337
TatI WGTACW 1 cut(s) 18
TscAI CASTG 2 cut(s) 202, 226
TspDTI ATGAA 1 cut(s) 66
TspRI CASTG 2 cut(s) 202, 226
XapI RAATTY 3 cut(s) 224, 331, 337
XspI CTAG 1 cut(s) 318
ZrmI AGTACT 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.