Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0004583

Physical Location & Seq

Genomic Coordinates Forward (+)

26597327 .. 26598474

Gene Structure 1148 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1188700.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

ATGTTTCCTCATATAGACAGAGTGCTGTTCTTATTTAAAAGGTCATTTCTCAGACCTCATTGGTTATTCTGGTGGAACTTTCTCATATCATTGGGCCAGATTACTGATGCTATTGCTGATTGCAGTCTACCTATAGCTCTTGATGGAAATTATCTAAAGGTTTGCTCAAAGCTGAAGTTTCCTAACGACCCTTTGATATGGCATTGCTCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001671 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005829 GO:0006457 GO:0006458 GO:0008047 GO:0008150 GO:0009987 GO:0030234 GO:0031072 GO:0031974 GO:0031981 GO:0032781 GO:0043085 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043462 GO:0044093 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0048583 GO:0050789 GO:0050790 GO:0050794 GO:0051084 GO:0051085 GO:0051336 GO:0051345 GO:0060589 GO:0060590 GO:0061077 GO:0065007 GO:0065009 GO:0070013 GO:0080134 GO:0080135 GO:0098772 GO:1900034

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ TPR_8

Protein Analysis

71

Amino Acids

8.31

Weight (kDa)

8.59

Isoelectric Point (pI)

34.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004583)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G12430
fragaria_vesca	FvH4_3g28360 FvH4_3g28360 FvH4_3g28360 FvH4_3g28360
malus_domestica	MD03G1171100.v1.1 MD03G1171300.v1.1 MD11G1188500.v1.1 MD11G1188700.v1.1
prunus_persica	Prupe.4G255700_v2.0.a1 Prupe.4G255700_v2.0.a1 Prupe.4G255700_v2.0.a1 Prupe.4G255700_v2.0.a1
pyrus_communis	pycom03g12820 pycom03g12830 pycom03g12840 pycom03g12860 pycom11g16530 pycom15g27190
rosa_chinensis	RchiOBHm_Chr5g0053371
rosa_laevigata	RLG00000034766
rosa_multiflora	Rmu_sc0001966.1_g000003
rosa_roxburghii	Rroxscaffold_1G00029100
rosa_rugosa	Rorug05G0267200 Rorug05G0267300
rosa_samantha	Rh5AG339800 Rh5BG350200 Rh5CG376600 Rh5DG364200
rosa_wichuraiana	Rw5G032070 Rw5G032080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	127
AcuI	CTGAAG	1 cut(s)	194
AluBI	AGCT	2 cut(s)	137, 172
AluI	AGCT	2 cut(s)	137, 172
AoxI	GGCC	1 cut(s)	94
AspS9I	GGNCC	1 cut(s)	94
BccI	CCATC	1 cut(s)	137
BfmI	CTRYAG	1 cut(s)	132
BmgT120I	GGNCC	1 cut(s)	94
BmsI	GCATC	1 cut(s)	97
Bse3DI	GCAATG	1 cut(s)	202
BseMI	GCAATG	1 cut(s)	202
BseMII	CTCAG	1 cut(s)	64
BshFI	GGCC	1 cut(s)	96
BsnI	GGCC	1 cut(s)	96
BspANI	GGCC	1 cut(s)	96
BspCNI	CTCAG	1 cut(s)	63
BspHI	TCATGA	1 cut(s)	209
BsrDI	GCAATG	1 cut(s)	202
BstDEI	CTNAG	1 cut(s)	50
BstSFI	CTRYAG	1 cut(s)	132
BsuRI	GGCC	1 cut(s)	96
CciI	TCATGA	1 cut(s)	209
Cfr13I	GGNCC	1 cut(s)	94
CviAII	CATG	1 cut(s)	210
CviJI	RGCY	3 cut(s)	96, 137, 172
CviKI_1	RGCY	3 cut(s)	96, 137, 172
DdeI	CTNAG	1 cut(s)	50
DraI	TTTAAA	1 cut(s)	37
Eco57I	CTGAAG	1 cut(s)	194
FaeI	CATG	1 cut(s)	213
FaiI	YATR	6 cut(s)	12, 14, 86, 134, 199, 211
FatI	CATG	1 cut(s)	209
FblI	GTMKAC	1 cut(s)	127
HaeIII	GGCC	1 cut(s)	96
Hin1II	CATG	1 cut(s)	213
Hpy166II	GTNNAC	1 cut(s)	128
Hpy188I	TCNGA	1 cut(s)	53
Hpy188III	TCNNGA	2 cut(s)	140, 210
Hpy8I	GTNNAC	1 cut(s)	128
HpyCH4V	TGCA	1 cut(s)	123
HpyF3I	CTNAG	1 cut(s)	50
Hsp92II	CATG	1 cut(s)	213
LpnPI	CCDG	2 cut(s)	55, 110
LweI	GCATC	1 cut(s)	97
MluCI	AATT	1 cut(s)	148
MnlI	CCTC	2 cut(s)	18, 66
MseI	TTAA	1 cut(s)	36
NlaIII	CATG	1 cut(s)	213
PagI	TCATGA	1 cut(s)	209
PspPI	GGNCC	1 cut(s)	94
SaqAI	TTAA	1 cut(s)	36
Sau96I	GGNCC	1 cut(s)	94
SetI	ASST	6 cut(s)	44, 58, 133, 139, 162, 174
SfaNI	GCATC	1 cut(s)	97
SfcI	CTRYAG	1 cut(s)	132
SgeI	CNNG	3 cut(s)	82, 109, 152
Sse9I	AATT	1 cut(s)	148
TasI	AATT	1 cut(s)	148
Tru1I	TTAA	1 cut(s)	36
Tru9I	TTAA	1 cut(s)	36
XmiI	GTMKAC	1 cut(s)	127

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.