MD12G1078300.v1.1

Belongs to the eukaryotic ribosomal protein eL36 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Forward (+)
9548066 .. 9549782
1717 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1078300.v1.1.491

Sequence Viewer

Length: 324 bp
ATGGCTCCCGCCGCCCCCAAGAGTGGGATCTTCGTCGGCCTCAACAAAGGCCACATCGTCACCAAGCGTGAATTGCCTCCTCGCCCATCTGACCGCAAGGGGAAAACAAGCAAGAGGGTGCATTTCGTGAGGAACTTGATCAGGGAAGTTGCGGGATTTGCTCCCTATGAGAAGAGGATTACGGAGCTTTTGAAGGTCGGGAAGGACAAGCGTGCTCTTAAGGTGGCCAAGCGAAAGTTGGGTACTCACAAGAGGGCCAAGAAGAAGAGAGAGGAGATGTCTAACGTTCTCCGCAAGATGAGGTCTGGTGGTGATAAGAAGTGA

Protein Analysis

108

Amino Acids

12.14

Weight (kDa)

11.43

Isoelectric Point (pI)

58.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L36e PF01158 8 - 101 6e-44 Ribosomal protein L36e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 9, 12, 94, 152, 292
AclI AACGTT 1 cut(s) 285
AclWI GGATC 1 cut(s) 35
AcoI YGGCCR 1 cut(s) 225
AfaI GTAC 1 cut(s) 244
AfiI CCNNNNNNNGG 2 cut(s) 23, 24
AflII CTTAAG 1 cut(s) 218
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
Alw21I GWGCWC 1 cut(s) 217
AlwI GGATC 1 cut(s) 35
AoxI GGCC 4 cut(s) 37, 49, 225, 255
AspS9I GGNCC 1 cut(s) 255
AsuHPI GGTGA 2 cut(s) 52, 323
BalI TGGCCA 1 cut(s) 227
Bbv12I GWGCWC 1 cut(s) 217
BccI CCATC 1 cut(s) 94
BclI TGATCA 1 cut(s) 138
BfrI CTTAAG 1 cut(s) 218
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 255
BmiI GGNNCC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 24
BseLI CCNNNNNNNGG 2 cut(s) 23, 24
BseRI GAGGAG 2 cut(s) 69, 287
BshFI GGCC 4 cut(s) 39, 51, 227, 257
BsiHKAI GWGCWC 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 23, 24
BsnI GGCC 4 cut(s) 39, 51, 227, 257
Bsp1286I GDGCHC 1 cut(s) 217
Bsp143I GATC 2 cut(s) 27, 138
BspACI CCGC 5 cut(s) 9, 12, 94, 152, 292
BspANI GGCC 4 cut(s) 39, 51, 227, 257
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 35
BspTI CTTAAG 1 cut(s) 218
BssMI GATC 2 cut(s) 27, 138
Bst6I CTCTTC 2 cut(s) 167, 260
BstAFI CTTAAG 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 213
BstKTI GATC 2 cut(s) 30, 141
BstMBI GATC 2 cut(s) 27, 138
BstMWI GCNNNNNNNGC 3 cut(s) 11, 73, 158
BstX2I RGATCY 1 cut(s) 27
BstYI RGATCY 1 cut(s) 27
BsuRI GGCC 4 cut(s) 39, 51, 227, 257
Cac8I GCNNGC 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 255
Csp6I GTAC 1 cut(s) 243
CviJI RGCY 6 cut(s) 5, 39, 51, 187, 227, 257
CviKI_1 RGCY 6 cut(s) 5, 39, 51, 187, 227, 257
CviQI GTAC 1 cut(s) 243
DpnI GATC 2 cut(s) 29, 140
DpnII GATC 2 cut(s) 27, 138
EaeI YGGCCR 1 cut(s) 225
Eam1104I CTCTTC 2 cut(s) 167, 260
EarI CTCTTC 2 cut(s) 167, 260
FaiI YATR 1 cut(s) 168
FauI CCCGC 2 cut(s) 16, 145
FbaI TGATCA 1 cut(s) 138
Fnu4HI GCNGC 1 cut(s) 12
Fsp4HI GCNGC 1 cut(s) 12
GluI GCNGC 1 cut(s) 12
HaeIII GGCC 4 cut(s) 39, 51, 227, 257
HphI GGTGA 2 cut(s) 52, 323
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 127, 199
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 2 cut(s) 187, 196
HpyCH4IV ACGT 1 cut(s) 285
HpyCH4V TGCA 1 cut(s) 121
HpyF10VI GCNNNNNNNGC 3 cut(s) 11, 73, 158
HpySE526I ACGT 1 cut(s) 285
Ksp22I TGATCA 1 cut(s) 138
Kzo9I GATC 2 cut(s) 27, 138
LmnI GCTCC 3 cut(s) 10, 166, 184
LpnPI CCDG 2 cut(s) 127, 291
MaeII ACGT 1 cut(s) 285
MaeIII GTNAC 1 cut(s) 58
MalI GATC 2 cut(s) 29, 140
MboI GATC 2 cut(s) 27, 138
MboII GAAGA 4 cut(s) 22, 184, 274, 277
MflI RGATCY 1 cut(s) 27
MhlI GDGCHC 1 cut(s) 217
MlsI TGGCCA 1 cut(s) 227
MluCI AATT 1 cut(s) 71
MluNI TGGCCA 1 cut(s) 227
MnlI CCTC 9 cut(s) 50, 87, 90, 108, 123, 168, 246, 265, 294
Mox20I TGGCCA 1 cut(s) 227
MscI TGGCCA 1 cut(s) 227
MseI TTAA 1 cut(s) 219
Msp20I TGGCCA 1 cut(s) 227
MspCI CTTAAG 1 cut(s) 218
MwoI GCNNNNNNNGC 3 cut(s) 11, 73, 158
NdeII GATC 2 cut(s) 27, 138
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 58
PkrI GCNGC 1 cut(s) 13
Psp1406I AACGTT 1 cut(s) 285
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 255
PsuI RGATCY 1 cut(s) 27
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
SaqAI TTAA 1 cut(s) 219
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 2 cut(s) 27, 138
Sau96I GGNCC 1 cut(s) 255
SduI GDGCHC 1 cut(s) 217
SetI ASST 5 cut(s) 189, 198, 225, 288, 305
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
Sse9I AATT 1 cut(s) 71
SsiI CCGC 5 cut(s) 9, 12, 94, 152, 292
TaiI ACGT 1 cut(s) 288
TasI AATT 1 cut(s) 71
TauI GCSGC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TseFI GTSAC 1 cut(s) 58
Tsp45I GTSAC 1 cut(s) 58
TspGWI ACGGA 1 cut(s) 197
Vha464I CTTAAG 1 cut(s) 218
XcmI CCANNNNNNNNNTGG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.