MD15G1222700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0001509
Physical Location & Seq
Forward (+)
18080442 .. 18082028
1587 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1222700.v1.1.491

Sequence Viewer

Length: 294 bp
ATGGAGGGTCTGCAGAAGTTGATTGGGAAAATCCCAAAAGACCCCCAAAAATTGGGCTCCGCTTCGGCTTCCTTCGACCCTCACCGTGGGACTGAAGGTCTCGCCGCCGCTCTGTCCTCCTCCGATCAGTCTCGTATTTTGCTCAACAGACCCGCCAGGCAGGTGGTTTCACTGTGGACATGCTCAAAGCTTTGTACACTTTGCTTTGTTGCTGGAATTGTTGTTGGTTATACGCTGAAGCGACGCGTCCGAAGTTGGGCTTCCAAACTTCTCAAGAAGATGAGAGATGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.66

Weight (kDa)

10.19

Isoelectric Point (pI)

41.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 151
Acc36I ACCTGC 1 cut(s) 151
AccB7I CCANNNNNTGG 1 cut(s) 52
AccBSI CCGCTC 1 cut(s) 110
AccII CGCG 1 cut(s) 246
AciI CCGC 4 cut(s) 60, 105, 108, 153
AcuI CTGAAG 2 cut(s) 114, 257
AfaI GTAC 1 cut(s) 196
AfiI CCNNNNNNNGG 3 cut(s) 52, 86, 256
AflIII ACRYGT 1 cut(s) 244
AhdI GACNNNNNGTC 1 cut(s) 96
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
Alw26I GTCTC 2 cut(s) 104, 135
AsuHPI GGTGA 1 cut(s) 74
BanII GRGCYC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 157
BcoDI GTCTC 2 cut(s) 104, 135
BfmI CTRYAG 1 cut(s) 11
BfuAI ACCTGC 1 cut(s) 151
BisI GCNGC 2 cut(s) 105, 108
BlsI GCNGC 2 cut(s) 106, 109
Bme1390I CCNGG 1 cut(s) 157
BmeRI GACNNNNNGTC 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 257
BsaI GGTCTC 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 3 cut(s) 52, 86, 256
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 85
BseLI CCNNNNNNNGG 3 cut(s) 52, 86, 256
BseRI GAGGAG 1 cut(s) 109
Bsh1236I CGCG 1 cut(s) 246
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 3 cut(s) 52, 86, 256
BsmAI GTCTC 2 cut(s) 104, 135
BsmFI GGGAC 1 cut(s) 103
Bso31I GGTCTC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 59
Bsp1407I TGTACA 1 cut(s) 194
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 4 cut(s) 60, 105, 108, 153
BspFNI CGCG 1 cut(s) 246
BspLI GGNNCC 1 cut(s) 58
BspMAI CTGCAG 1 cut(s) 15
BspMI ACCTGC 1 cut(s) 151
BspTNI GGTCTC 1 cut(s) 104
BsrBI CCGCTC 1 cut(s) 110
BsrGI TGTACA 1 cut(s) 194
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 1 cut(s) 124
Bst2UI CCWGG 1 cut(s) 157
Bst4CI ACNGT 2 cut(s) 86, 174
BstAUI TGTACA 1 cut(s) 194
BstDSI CCRYGG 1 cut(s) 85
BstFNI CGCG 1 cut(s) 246
BstKTI GATC 1 cut(s) 127
BstMAI GTCTC 2 cut(s) 104, 135
BstMBI GATC 1 cut(s) 124
BstNI CCWGG 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 11
BstUI CGCG 1 cut(s) 246
BstXI CCANNNNNNTGG 1 cut(s) 163
BtgI CCRYGG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 170
BveI ACCTGC 1 cut(s) 151
CseI GACGC 2 cut(s) 235, 252
Csp6I GTAC 1 cut(s) 195
CviAII CATG 1 cut(s) 180
CviJI RGCY 4 cut(s) 57, 68, 190, 260
CviKI_1 RGCY 4 cut(s) 57, 68, 190, 260
CviQI GTAC 1 cut(s) 195
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
DriI GACNNNNNGTC 1 cut(s) 96
Eam1105I GACNNNNNGTC 1 cut(s) 96
Eco24I GRGCYC 1 cut(s) 59
Eco31I GGTCTC 1 cut(s) 104
Eco57I CTGAAG 2 cut(s) 114, 257
EcoRII CCWGG 1 cut(s) 155
EcoT38I GRGCYC 1 cut(s) 59
FaeI CATG 1 cut(s) 183
FaiI YATR 2 cut(s) 181, 231
FalI AAGNNNNNCTT 2 cut(s) 244, 276
FaqI GGGAC 1 cut(s) 103
FatI CATG 1 cut(s) 179
FauI CCCGC 1 cut(s) 160
Fnu4HI GCNGC 2 cut(s) 105, 108
FriOI GRGCYC 1 cut(s) 59
Fsp4HI GCNGC 2 cut(s) 105, 108
GluI GCNGC 2 cut(s) 105, 108
HgaI GACGC 2 cut(s) 235, 252
Hin1II CATG 1 cut(s) 183
HindIII AAGCTT 1 cut(s) 188
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 2 cut(s) 177, 197
Hpy188I TCNGA 2 cut(s) 124, 251
Hpy188III TCNNGA 1 cut(s) 274
Hpy8I GTNNAC 2 cut(s) 177, 197
Hpy99I CGWCG 1 cut(s) 246
HpyAV CCTTC 2 cut(s) 82, 89
HpyCH4III ACNGT 2 cut(s) 86, 174
HpyCH4V TGCA 1 cut(s) 13
Hsp92II CATG 1 cut(s) 183
Kzo9I GATC 1 cut(s) 124
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 4 cut(s) 142, 146, 169, 198
MalI GATC 1 cut(s) 126
MbiI CCGCTC 1 cut(s) 110
MboI GATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 289
MhlI GDGCHC 1 cut(s) 59
MluCI AATT 2 cut(s) 50, 216
MluI ACGCGT 1 cut(s) 244
MnlI CCTC 3 cut(s) 90, 127, 130
MspR9I CCNGG 1 cut(s) 157
MvaI CCWGG 1 cut(s) 157
MvnI CGCG 1 cut(s) 246
NdeII GATC 1 cut(s) 124
NlaIII CATG 1 cut(s) 183
NlaIV GGNNCC 1 cut(s) 58
NspI RCATGY 1 cut(s) 183
PaqCI CACCTGC 1 cut(s) 151
PflMI CCANNNNNTGG 1 cut(s) 52
PkrI GCNGC 2 cut(s) 106, 109
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PspN4I GGNNCC 1 cut(s) 58
PstI CTGCAG 1 cut(s) 15
RsaI GTAC 1 cut(s) 196
RsaNI GTAC 1 cut(s) 195
SatI GCNGC 2 cut(s) 105, 108
Sau3AI GATC 1 cut(s) 124
ScrFI CCNGG 1 cut(s) 157
SduI GDGCHC 1 cut(s) 59
SetI ASST 3 cut(s) 100, 165, 192
SfcI CTRYAG 1 cut(s) 11
SmlI CTYRAG 1 cut(s) 272
SmoI CTYRAG 1 cut(s) 272
Sse9I AATT 2 cut(s) 50, 216
SsiI CCGC 4 cut(s) 60, 105, 108, 153
StyD4I CCNGG 1 cut(s) 155
TaaI ACNGT 2 cut(s) 86, 174
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 50, 216
TatI WGTACW 1 cut(s) 194
TauI GCSGC 2 cut(s) 107, 110
TscAI CASTG 1 cut(s) 177
TspRI CASTG 1 cut(s) 177
Van91I CCANNNNNTGG 1 cut(s) 52
XceI RCATGY 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.