Rw6G020630

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
41130447 .. 41131091
645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G020630.1

Sequence Viewer

Length: 276 bp
ATGTACCAGCTCCTCCCACACCAATCCGAAGAATCTTCATCATCTTCTTCTTCTTCTTCCTTTGAAGGTCCTCGTTCTACTGAGGGCCTCTCTACCGCTTTGTCCGATCAGTCTCGTATTATAGTCGCCAGACCTGTTAGAGGAGTGGTGTCCCTGTGGACATGCTCAAAGTTCTGTGCAATTGCCTTTGTTGCTGGGATCATTGTTGGCTATACCCTGAAGCGACGCGTTAAACGCTGGGCTAACAAGCTTCTCAAGAGGATCAAAGACAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.09

Weight (kDa)

10.22

Isoelectric Point (pI)

76.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 228
AciI CCGC 1 cut(s) 96
AclWI GGATC 2 cut(s) 206, 269
AcuI CTGAAG 1 cut(s) 239
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 140
AflIII ACRYGT 1 cut(s) 226
AgsI TTSAA 1 cut(s) 65
AluBI AGCT 2 cut(s) 10, 250
AluI AGCT 2 cut(s) 10, 250
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 2 cut(s) 206, 269
AoxI GGCC 1 cut(s) 85
AspS9I GGNCC 2 cut(s) 68, 85
AvaII GGWCC 1 cut(s) 68
BcoDI GTCTC 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 2 cut(s) 68, 85
BplI GAGNNNNNCTC 2 cut(s) 74, 106
BpuEI CTTGAG 1 cut(s) 239
Bsc4I CCNNNNNNNGG 1 cut(s) 140
BseLI CCNNNNNNNGG 1 cut(s) 140
BseMII CTCAG 1 cut(s) 72
BseRI GAGGAG 1 cut(s) 156
BseYI CCCAGC 2 cut(s) 194, 237
Bsh1236I CGCG 1 cut(s) 228
BshFI GGCC 1 cut(s) 87
BslFI GGGAC 1 cut(s) 136
BslI CCNNNNNNNGG 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 136
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 3 cut(s) 106, 198, 261
BspACI CCGC 1 cut(s) 96
BspANI GGCC 1 cut(s) 87
BspCNI CTCAG 1 cut(s) 73
BspFNI CGCG 1 cut(s) 228
BspPI GGATC 2 cut(s) 206, 269
BssMI GATC 3 cut(s) 106, 198, 261
BstDEI CTNAG 1 cut(s) 81
BstENI CCTNNNNNAGG 1 cut(s) 138
BstFNI CGCG 1 cut(s) 228
BstKTI GATC 3 cut(s) 109, 201, 264
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 3 cut(s) 106, 198, 261
BstMWI GCNNNNNNNGC 2 cut(s) 191, 234
BstNSI RCATGY 1 cut(s) 165
BstUI CGCG 1 cut(s) 228
BsuRI GGCC 1 cut(s) 87
Cfr13I GGNCC 2 cut(s) 68, 85
CseI GACGC 1 cut(s) 234
Csp6I GTAC 1 cut(s) 4
CviAII CATG 1 cut(s) 162
CviJI RGCY 5 cut(s) 10, 87, 210, 242, 250
CviKI_1 RGCY 5 cut(s) 10, 87, 210, 242, 250
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 81
DpnI GATC 3 cut(s) 108, 200, 263
DpnII GATC 3 cut(s) 106, 198, 261
Eco47I GGWCC 1 cut(s) 68
Eco57I CTGAAG 1 cut(s) 239
EcoNI CCTNNNNNAGG 1 cut(s) 138
EcoO109I RGGNCCY 2 cut(s) 68, 85
FaeI CATG 1 cut(s) 165
FaiI YATR 3 cut(s) 122, 163, 213
FaqI GGGAC 1 cut(s) 136
FatI CATG 1 cut(s) 161
GsaI CCCAGC 2 cut(s) 198, 241
HaeIII GGCC 1 cut(s) 87
HgaI GACGC 1 cut(s) 234
Hin1II CATG 1 cut(s) 165
HindIII AAGCTT 1 cut(s) 248
HinfI GANTC 1 cut(s) 32
Hpy166II GTNNAC 1 cut(s) 159
Hpy188I TCNGA 2 cut(s) 28, 106
Hpy188III TCNNGA 1 cut(s) 256
Hpy8I GTNNAC 1 cut(s) 159
Hpy99I CGWCG 1 cut(s) 228
HpyAV CCTTC 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 191, 234
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 1 cut(s) 165
Kzo9I GATC 3 cut(s) 106, 198, 261
LmnI GCTCC 1 cut(s) 15
LpnPI CCDG 7 cut(s) 20, 142, 147, 167, 180, 223, 230
MalI GATC 3 cut(s) 108, 200, 263
MboI GATC 3 cut(s) 106, 198, 261
MboII GAAGA 7 cut(s) 27, 36, 39, 41, 42, 45, 48
MfeI CAATTG 2 cut(s) 180, 271
MluCI AATT 2 cut(s) 180, 271
MluI ACGCGT 1 cut(s) 226
MnlI CCTC 6 cut(s) 23, 76, 81, 98, 134, 252
MseI TTAA 1 cut(s) 231
MunI CAATTG 2 cut(s) 180, 271
MvnI CGCG 1 cut(s) 228
MwoI GCNNNNNNNGC 2 cut(s) 191, 234
NdeII GATC 3 cut(s) 106, 198, 261
NlaIII CATG 1 cut(s) 165
NspI RCATGY 1 cut(s) 165
PfeI GAWTC 1 cut(s) 32
PpuMI RGGWCCY 1 cut(s) 68
Psp5II RGGWCCY 1 cut(s) 68
PspFI CCCAGC 2 cut(s) 194, 237
PspPI GGNCC 2 cut(s) 68, 85
PspPPI RGGWCCY 1 cut(s) 68
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 231
Sau3AI GATC 3 cut(s) 106, 198, 261
Sau96I GGNCC 2 cut(s) 68, 85
SetI ASST 4 cut(s) 12, 70, 136, 252
SinI GGWCC 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 254
SmoI CTYRAG 1 cut(s) 254
Sse9I AATT 2 cut(s) 180, 271
SsiI CCGC 1 cut(s) 96
TasI AATT 2 cut(s) 180, 271
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TspDTI ATGAA 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 68
XagI CCTNNNNNAGG 1 cut(s) 138
XceI RCATGY 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.