pycom02g07770

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
5472065 .. 5472328
264 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g07770.2

Sequence Viewer

Length: 186 bp
ATGGAGGGTTTGCAGAAGTTGATTGGGAAAATCCCGAAAGACCCCCCAAAATTGGGCTCCGCGTCGGCTTCCTTCGACCCTCACCGTGGGACTGAAGGTCTCGCCGCCGCTGTCTTCCTCCGATCAGTCTCGTATTTTGCTCAACAGACCCACCAGTCTGTGAATTGGGTTGCGTTTGGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.56

Weight (kDa)

9.4

Isoelectric Point (pI)

32.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 154
AccII CGCG 1 cut(s) 62
AciI CCGC 3 cut(s) 60, 105, 108
AcuI CTGAAG 1 cut(s) 114
AfiI CCNNNNNNNGG 3 cut(s) 52, 53, 86
AhdI GACNNNNNGTC 1 cut(s) 96
Alw26I GTCTC 2 cut(s) 104, 133
AsuHPI GGTGA 1 cut(s) 74
BanII GRGCYC 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 106
BcoDI GTCTC 2 cut(s) 104, 133
BisI GCNGC 2 cut(s) 105, 108
BlsI GCNGC 2 cut(s) 106, 109
BmeRI GACNNNNNGTC 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 106
BsaI GGTCTC 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 3 cut(s) 52, 53, 86
Bse1I ACTGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 85
BseLI CCNNNNNNNGG 3 cut(s) 52, 53, 86
BseNI ACTGG 1 cut(s) 154
Bsh1236I CGCG 1 cut(s) 62
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 3 cut(s) 52, 53, 86
BsmAI GTCTC 2 cut(s) 104, 133
BsmFI GGGAC 1 cut(s) 103
Bso31I GGTCTC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 59
Bsp143I GATC 1 cut(s) 122
BspACI CCGC 3 cut(s) 60, 105, 108
BspFNI CGCG 1 cut(s) 62
BspLI GGNNCC 1 cut(s) 58
BspTNI GGTCTC 1 cut(s) 104
BsrI ACTGG 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 86
BstDSI CCRYGG 1 cut(s) 85
BstFNI CGCG 1 cut(s) 62
BstKTI GATC 1 cut(s) 125
BstMAI GTCTC 2 cut(s) 104, 133
BstMBI GATC 1 cut(s) 122
BstUI CGCG 1 cut(s) 62
BstV2I GAAGAC 1 cut(s) 106
BtgI CCRYGG 1 cut(s) 85
CseI GACGC 1 cut(s) 51
CviJI RGCY 2 cut(s) 57, 68
CviKI_1 RGCY 2 cut(s) 57, 68
DpnI GATC 1 cut(s) 124
DpnII GATC 1 cut(s) 122
DrdI GACNNNNNNGTC 1 cut(s) 154
DriI GACNNNNNGTC 1 cut(s) 96
DseDI GACNNNNNNGTC 1 cut(s) 154
Eam1105I GACNNNNNGTC 1 cut(s) 96
Eco24I GRGCYC 1 cut(s) 59
Eco31I GGTCTC 1 cut(s) 104
Eco57I CTGAAG 1 cut(s) 114
EcoT38I GRGCYC 1 cut(s) 59
FaqI GGGAC 1 cut(s) 103
Fnu4HI GCNGC 2 cut(s) 105, 108
FriOI GRGCYC 1 cut(s) 59
Fsp4HI GCNGC 2 cut(s) 105, 108
GluI GCNGC 2 cut(s) 105, 108
HgaI GACGC 1 cut(s) 51
HphI GGTGA 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 122
Hpy188III TCNNGA 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 67
HpyAV CCTTC 2 cut(s) 82, 89
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 13
Kzo9I GATC 1 cut(s) 122
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 1 cut(s) 167
MalI GATC 1 cut(s) 124
MboI GATC 1 cut(s) 122
MboII GAAGA 1 cut(s) 106
MhlI GDGCHC 1 cut(s) 59
MluCI AATT 2 cut(s) 50, 163
MnlI CCTC 2 cut(s) 90, 128
MspA1I CMGCKG 1 cut(s) 110
MvnI CGCG 1 cut(s) 62
NdeII GATC 1 cut(s) 122
NlaIV GGNNCC 1 cut(s) 58
PkrI GCNGC 2 cut(s) 106, 109
PspN4I GGNNCC 1 cut(s) 58
SatI GCNGC 2 cut(s) 105, 108
Sau3AI GATC 1 cut(s) 122
SduI GDGCHC 1 cut(s) 59
SetI ASST 1 cut(s) 100
SgeI CNNG 6 cut(s) 46, 73, 98, 113, 142, 166
Sse9I AATT 2 cut(s) 50, 163
SsiI CCGC 3 cut(s) 60, 105, 108
TaaI ACNGT 1 cut(s) 86
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 50, 163
TauI GCSGC 2 cut(s) 107, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.