MD17G1070100.v1.1

Late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
5676026 .. 5676534
509 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1070100.v1.1.491

Sequence Viewer

Length: 204 bp
ATGGCTGACAACTCCCAGAAGATGAGCTACCAAGCTGGAGAGGCCAAGGGCCAAGCTCAGGAGAAGGCCAGTGGAATGATGGACAAGGCTAACAATGCCGCCCAATCTGCCAAGGAAACAATGCAGGATGCTGGCCAGAACATGCAGGCCAAGGCACAGGGAGCTGCCGATGCAGTCAAGAACGCCACCGGCATGAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

6.94

Weight (kDa)

8.01

Isoelectric Point (pI)

29.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 99
AcoI YGGCCR 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 58
AluBI AGCT 4 cut(s) 27, 35, 56, 164
AluI AGCT 4 cut(s) 27, 35, 56, 164
AoxI GGCC 5 cut(s) 42, 49, 66, 133, 147
ApeKI GCWGC 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 49
BalI TGGCCA 1 cut(s) 135
BarI GAAGNNNNNNTAC 2 cut(s) 11, 43
BbvI GCAGC 1 cut(s) 151
BccI CCATC 1 cut(s) 73
BisI GCNGC 2 cut(s) 99, 165
BlsI GCNGC 2 cut(s) 100, 166
BmgT120I GGNCC 1 cut(s) 49
BmsI GCATC 2 cut(s) 118, 160
BpmI CTGGAG 1 cut(s) 57
Bpu10I CCTNAGC 1 cut(s) 57
BsaJI CCNNGG 3 cut(s) 45, 111, 150
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse118I RCCGGY 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 69
BseDI CCNNGG 3 cut(s) 45, 111, 150
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMII CTCAG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 69
BseXI GCAGC 1 cut(s) 151
BshFI GGCC 5 cut(s) 44, 51, 68, 135, 149
BsiSI CCGG 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 58
BsnI GGCC 5 cut(s) 44, 51, 68, 135, 149
BspACI CCGC 1 cut(s) 99
BspANI GGCC 5 cut(s) 44, 51, 68, 135, 149
BspCNI CTCAG 1 cut(s) 70
BsrFI RCCGGY 1 cut(s) 188
BsrI ACTGG 1 cut(s) 69
BssAI RCCGGY 1 cut(s) 188
BssECI CCNNGG 3 cut(s) 45, 111, 150
BssT1I CCWWGG 3 cut(s) 45, 111, 150
BstC8I GCNNGC 2 cut(s) 133, 147
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 133
BstMWI GCNNNNNNNGC 5 cut(s) 41, 95, 107, 161, 170
BstNSI RCATGY 1 cut(s) 145
BstV1I GCAGC 1 cut(s) 151
BsuRI GGCC 5 cut(s) 44, 51, 68, 135, 149
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 76
Cac8I GCNNGC 2 cut(s) 133, 147
Cfr10I RCCGGY 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 2 cut(s) 142, 193
DdeI CTNAG 1 cut(s) 57
EaeI YGGCCR 1 cut(s) 133
Eco130I CCWWGG 3 cut(s) 45, 111, 150
EcoT14I CCWWGG 3 cut(s) 45, 111, 150
ErhI CCWWGG 3 cut(s) 45, 111, 150
FaeI CATG 2 cut(s) 145, 196
FaiI YATR 2 cut(s) 143, 194
FatI CATG 2 cut(s) 141, 192
Fnu4HI GCNGC 2 cut(s) 99, 165
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 2 cut(s) 99, 165
GluI GCNGC 2 cut(s) 99, 165
GsuI CTGGAG 1 cut(s) 57
HaeIII GGCC 5 cut(s) 44, 51, 68, 135, 149
HapII CCGG 1 cut(s) 189
Hin1II CATG 2 cut(s) 145, 196
HpaII CCGG 1 cut(s) 189
Hpy188III TCNNGA 2 cut(s) 59, 178
HpyAV CCTTC 1 cut(s) 58
HpyCH4V TGCA 3 cut(s) 124, 145, 173
HpyF10VI GCNNNNNNNGC 5 cut(s) 41, 95, 107, 161, 170
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 2 cut(s) 145, 196
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 9 cut(s) 21, 29, 44, 82, 110, 117, 131, 143, 149
Lsp1109I GCAGC 1 cut(s) 151
LweI GCATC 2 cut(s) 118, 160
MboII GAAGA 1 cut(s) 31
MlsI TGGCCA 1 cut(s) 135
MluNI TGGCCA 1 cut(s) 135
MnlI CCTC 1 cut(s) 34
Mox20I TGGCCA 1 cut(s) 135
MscI TGGCCA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 191
Msp20I TGGCCA 1 cut(s) 135
MspI CCGG 1 cut(s) 189
MwoI GCNNNNNNNGC 5 cut(s) 41, 95, 107, 161, 170
NlaIII CATG 2 cut(s) 145, 196
NspI RCATGY 1 cut(s) 145
PkrI GCNGC 2 cut(s) 100, 166
PspPI GGNCC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 191
SatI GCNGC 2 cut(s) 99, 165
Sau96I GGNCC 1 cut(s) 49
SetI ASST 4 cut(s) 29, 37, 58, 166
SfaNI GCATC 2 cut(s) 118, 160
SmiMI CAYNNNNRTG 1 cut(s) 191
SsiI CCGC 1 cut(s) 99
StyI CCWWGG 3 cut(s) 45, 111, 150
TauI GCSGC 1 cut(s) 101
TscAI CASTG 1 cut(s) 76
TseI GCWGC 1 cut(s) 164
TspRI CASTG 1 cut(s) 76
XceI RCATGY 1 cut(s) 145
XcmI CCANNNNNNNNNTGG 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.