Prupe.3G244600_v2.0.a1

Late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Forward (+)
23650993 .. 23651671
679 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G244600.1

Sequence Viewer

Length: 204 bp
ATGGCTGACAACTCTCAGAAGATGAGCTACCACGCTGGTGAGGCCAAGGGCCAAGCTCAGGAGAAGGCTAGTGGGATGATGGATAAAGCTAACAATGCAGCCCAATCTACCAAGGAGACAATGCAAGATGTTGGTCAGAATGTGCATGCGAAGGCTCAAGGAGCTGCTGATGCAGTCAAGAATGCAACTGGCATGAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

6.98

Weight (kDa)

8.05

Isoelectric Point (pI)

31.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 58
AleI CACNNNNGTG 1 cut(s) 36
AluBI AGCT 4 cut(s) 27, 56, 89, 164
AluI AGCT 4 cut(s) 27, 56, 89, 164
Alw26I GTCTC 1 cut(s) 110
AoxI GGCC 2 cut(s) 42, 49
ApeKI GCWGC 2 cut(s) 98, 164
AspS9I GGNCC 1 cut(s) 49
AsuHPI GGTGA 1 cut(s) 50
BarI GAAGNNNNNNTAC 2 cut(s) 11, 43
BbvI GCAGC 2 cut(s) 110, 151
BccI CCATC 1 cut(s) 73
BcoDI GTCTC 1 cut(s) 110
BfaI CTAG 1 cut(s) 69
BisI GCNGC 2 cut(s) 99, 165
BlsI GCNGC 2 cut(s) 100, 166
BmgT120I GGNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 160
Bpu10I CCTNAGC 1 cut(s) 57
BpuEI CTTGAG 1 cut(s) 141
BsaJI CCNNGG 2 cut(s) 45, 111
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 193
BseDI CCNNGG 2 cut(s) 45, 111
BseGI GGATG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMII CTCAG 2 cut(s) 29, 71
BseNI ACTGG 1 cut(s) 193
BseXI GCAGC 2 cut(s) 110, 151
BshFI GGCC 2 cut(s) 44, 51
BslI CCNNNNNNNGG 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 110
BsmI GAATGC 1 cut(s) 187
BsnI GGCC 2 cut(s) 44, 51
BspANI GGCC 2 cut(s) 44, 51
BspCNI CTCAG 2 cut(s) 28, 70
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 2 cut(s) 45, 111
BssT1I CCWWGG 2 cut(s) 45, 111
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 2 cut(s) 15, 57
BstF5I GGATG 1 cut(s) 81
BstMAI GTCTC 1 cut(s) 110
BstMWI GCNNNNNNNGC 4 cut(s) 41, 95, 161, 170
BstNSI RCATGY 1 cut(s) 149
BstV1I GCAGC 2 cut(s) 110, 151
BsuRI GGCC 2 cut(s) 44, 51
BtsCI GGATG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 2 cut(s) 146, 193
DdeI CTNAG 2 cut(s) 15, 57
Eco130I CCWWGG 2 cut(s) 45, 111
EcoT14I CCWWGG 2 cut(s) 45, 111
ErhI CCWWGG 2 cut(s) 45, 111
FaeI CATG 2 cut(s) 149, 196
FaiI YATR 2 cut(s) 147, 194
FatI CATG 2 cut(s) 145, 192
Fnu4HI GCNGC 2 cut(s) 99, 165
FokI GGATG 1 cut(s) 88
Fsp4HI GCNGC 2 cut(s) 99, 165
FspBI CTAG 1 cut(s) 69
GluI GCNGC 2 cut(s) 99, 165
HaeIII GGCC 2 cut(s) 44, 51
Hin1II CATG 2 cut(s) 149, 196
HphI GGTGA 1 cut(s) 50
Hpy188I TCNGA 2 cut(s) 18, 138
Hpy188III TCNNGA 2 cut(s) 59, 178
HpyAV CCTTC 2 cut(s) 58, 145
HpyCH4V TGCA 5 cut(s) 98, 124, 145, 173, 185
HpyF10VI GCNNNNNNNGC 4 cut(s) 41, 95, 161, 170
HpyF3I CTNAG 2 cut(s) 15, 57
Hsp92II CATG 2 cut(s) 149, 196
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 3 cut(s) 21, 44, 174
Lsp1109I GCAGC 2 cut(s) 110, 151
LweI GCATC 1 cut(s) 160
MaeI CTAG 1 cut(s) 69
MboII GAAGA 1 cut(s) 31
MnlI CCTC 1 cut(s) 34
MslI CAYNNNNRTG 1 cut(s) 36
Mva1269I GAATGC 1 cut(s) 187
MwoI GCNNNNNNNGC 4 cut(s) 41, 95, 161, 170
NlaIII CATG 2 cut(s) 149, 196
NspI RCATGY 1 cut(s) 149
OliI CACNNNNGTG 1 cut(s) 36
PaeI GCATGC 1 cut(s) 149
PctI GAATGC 1 cut(s) 187
PkrI GCNGC 2 cut(s) 100, 166
PspPI GGNCC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 36
SatI GCNGC 2 cut(s) 99, 165
Sau96I GGNCC 1 cut(s) 49
SetI ASST 4 cut(s) 29, 58, 91, 166
SfaNI GCATC 1 cut(s) 160
SmiMI CAYNNNNRTG 1 cut(s) 36
SmlI CTYRAG 1 cut(s) 156
SmoI CTYRAG 1 cut(s) 156
SphI GCATGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 69
StyI CCWWGG 2 cut(s) 45, 111
TseI GCWGC 2 cut(s) 98, 164
XceI RCATGY 1 cut(s) 149
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.