Prupe.3G244700_v2.0.a1

Late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Forward (+)
23653143 .. 23653839
697 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G244700.1

Sequence Viewer

Length: 207 bp
ATGGCTTCCAACTCTGAGAAGGTGAGCTACCACGCTGGTGAGGCCAAGGGCCAAGCTCAGGAGAAGGCGAGTGGGGTGATGGATATGGCAAACAATGCAGCCCAATCTGCCAAGGAAACAATGCAAGCGGCAGGCCAGAATGTGCAGGCCACGGCTATAGGAGCTGCTGATGCAGTCAAGAATGCCACTGGCATGAACAAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

6.87

Weight (kDa)

8.06

Isoelectric Point (pI)

22.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 128
AfiI CCNNNNNNNGG 1 cut(s) 58
AleI CACNNNNGTG 1 cut(s) 36
AluBI AGCT 3 cut(s) 27, 56, 164
AluI AGCT 3 cut(s) 27, 56, 164
AoxI GGCC 4 cut(s) 42, 49, 133, 147
ApeKI GCWGC 2 cut(s) 98, 164
AspS9I GGNCC 1 cut(s) 49
AsuHPI GGTGA 3 cut(s) 34, 50, 88
BarI GAAGNNNNNNTAC 2 cut(s) 11, 43
BbvI GCAGC 2 cut(s) 110, 151
BccI CCATC 1 cut(s) 73
BceAI ACGGC 1 cut(s) 168
BfmI CTRYAG 1 cut(s) 156
BisI GCNGC 3 cut(s) 99, 129, 165
BlsI GCNGC 3 cut(s) 100, 130, 166
BmgT120I GGNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 160
Bpu10I CCTNAGC 1 cut(s) 57
BsaJI CCNNGG 3 cut(s) 45, 111, 150
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 193
BseDI CCNNGG 3 cut(s) 45, 111, 150
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMII CTCAG 2 cut(s) 6, 71
BseNI ACTGG 1 cut(s) 193
BseXI GCAGC 2 cut(s) 110, 151
BsgI GTGCAG 1 cut(s) 164
BshFI GGCC 4 cut(s) 44, 51, 135, 149
BslI CCNNNNNNNGG 1 cut(s) 58
BsmI GAATGC 1 cut(s) 187
BsnI GGCC 4 cut(s) 44, 51, 135, 149
BspACI CCGC 1 cut(s) 128
BspANI GGCC 4 cut(s) 44, 51, 135, 149
BspCNI CTCAG 2 cut(s) 7, 70
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 3 cut(s) 45, 111, 150
BssT1I CCWWGG 2 cut(s) 45, 111
BstAPI GCANNNNNTGC 1 cut(s) 95
BstC8I GCNNGC 3 cut(s) 126, 133, 147
BstDEI CTNAG 2 cut(s) 15, 57
BstDSI CCRYGG 1 cut(s) 150
BstMWI GCNNNNNNNGC 5 cut(s) 41, 95, 107, 161, 170
BstSFI CTRYAG 1 cut(s) 156
BstV1I GCAGC 2 cut(s) 110, 151
BsuRI GGCC 4 cut(s) 44, 51, 135, 149
BtgI CCRYGG 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 186
Cac8I GCNNGC 3 cut(s) 126, 133, 147
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 1 cut(s) 193
DdeI CTNAG 2 cut(s) 15, 57
Eco130I CCWWGG 2 cut(s) 45, 111
EcoT14I CCWWGG 2 cut(s) 45, 111
ErhI CCWWGG 2 cut(s) 45, 111
FaeI CATG 1 cut(s) 196
FaiI YATR 3 cut(s) 86, 158, 194
FatI CATG 1 cut(s) 192
Fnu4HI GCNGC 3 cut(s) 99, 129, 165
Fsp4HI GCNGC 3 cut(s) 99, 129, 165
GluI GCNGC 3 cut(s) 99, 129, 165
HaeIII GGCC 4 cut(s) 44, 51, 135, 149
Hin1II CATG 1 cut(s) 196
HphI GGTGA 3 cut(s) 34, 50, 88
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 59, 178
HpyAV CCTTC 2 cut(s) 13, 58
HpyCH4V TGCA 4 cut(s) 98, 124, 145, 173
HpyF10VI GCNNNNNNNGC 5 cut(s) 41, 95, 107, 161, 170
HpyF3I CTNAG 2 cut(s) 15, 57
Hsp92II CATG 1 cut(s) 196
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 6 cut(s) 21, 44, 117, 131, 149, 174
Lsp1109I GCAGC 2 cut(s) 110, 151
LweI GCATC 1 cut(s) 160
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 1 cut(s) 34
MslI CAYNNNNRTG 2 cut(s) 36, 191
Mva1269I GAATGC 1 cut(s) 187
MwoI GCNNNNNNNGC 5 cut(s) 41, 95, 107, 161, 170
NlaIII CATG 1 cut(s) 196
OliI CACNNNNGTG 1 cut(s) 36
PctI GAATGC 1 cut(s) 187
PkrI GCNGC 3 cut(s) 100, 130, 166
PspPI GGNCC 1 cut(s) 49
RseI CAYNNNNRTG 2 cut(s) 36, 191
SatI GCNGC 3 cut(s) 99, 129, 165
Sau96I GGNCC 1 cut(s) 49
SetI ASST 4 cut(s) 24, 29, 58, 166
SfaNI GCATC 1 cut(s) 160
SfcI CTRYAG 1 cut(s) 156
SmiMI CAYNNNNRTG 2 cut(s) 36, 191
SsiI CCGC 1 cut(s) 128
StyI CCWWGG 2 cut(s) 45, 111
TauI GCSGC 1 cut(s) 131
TscAI CASTG 1 cut(s) 193
TseI GCWGC 2 cut(s) 98, 164
TspRI CASTG 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.