RchiOBHm_Chr2g0163981

Stress-induced protein KIN2-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0003106
Physical Location & Seq
Forward (+)
79220851 .. 79221465
615 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53211

Sequence Viewer

Length: 321 bp
ATGGATAAGATGAGCTACAACGCCGGTGTGGCCAAGGGCCAAACTCAGGAGAAGGCCAGCACCATGATGGACAAGGCCGGGAATGTTGCACAGTCCGCCAAGGAATCGATACAGAATGCTGGCCAAGTGGATAACTCGCAGAAGATGAGCTACCACGCTGGGGAGGCCAAGGGCCAAACTCAGGCCAGCACCATGATGGACAAGGCCGGGAATGCCGCACAGTCCGCCAAGGAATCGATGCAGAATGCTGGCCAAGCTATTCAGAATACTGCTGCGGGAGCTGCTGACGCCGTCAAGAATGCTACTGGCATGAACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

10.88

Weight (kDa)

8.93

Isoelectric Point (pI)

28.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 96, 216, 225, 275
AcoI YGGCCR 3 cut(s) 30, 121, 250
AcyI GRCGYC 1 cut(s) 288
AfiI CCNNNNNNNGG 3 cut(s) 46, 160, 181
AluBI AGCT 4 cut(s) 15, 150, 257, 281
AluI AGCT 4 cut(s) 15, 150, 257, 281
ApeKI GCWGC 2 cut(s) 272, 281
AspS9I GGNCC 2 cut(s) 37, 172
AsuC2I CCSGG 2 cut(s) 79, 208
BalI TGGCCA 3 cut(s) 32, 123, 252
BarI GAAGNNNNNNTAC 2 cut(s) 134, 166
BbvI GCAGC 2 cut(s) 259, 268
BccI CCATC 2 cut(s) 61, 190
BceAI ACGGC 1 cut(s) 275
BcnI CCSGG 2 cut(s) 79, 208
BglI GCCNNNNNGGC 1 cut(s) 29
BisI GCNGC 3 cut(s) 216, 273, 282
BlsI GCNGC 3 cut(s) 217, 274, 283
Bme1390I CCNGG 2 cut(s) 79, 208
BmgT120I GGNCC 2 cut(s) 37, 172
BmrFI CCNGG 2 cut(s) 79, 208
BmsI GCATC 1 cut(s) 228
BpuMI CCSGG 2 cut(s) 79, 208
Bsa29I ATCGAT 2 cut(s) 107, 236
BsaHI GRCGYC 1 cut(s) 288
BsaJI CCNNGG 4 cut(s) 33, 99, 168, 228
Bsc4I CCNNNNNNNGG 3 cut(s) 46, 160, 181
Bse118I RCCGGY 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 310
BseCI ATCGAT 2 cut(s) 107, 236
BseDI CCNNGG 4 cut(s) 33, 99, 168, 228
BseLI CCNNNNNNNGG 3 cut(s) 46, 160, 181
BseMII CTCAG 2 cut(s) 59, 194
BseNI ACTGG 1 cut(s) 310
BseXI GCAGC 2 cut(s) 259, 268
BseYI CCCAGC 1 cut(s) 158
BshVI ATCGAT 2 cut(s) 107, 236
BsiSI CCGG 3 cut(s) 24, 78, 207
BslI CCNNNNNNNGG 3 cut(s) 46, 160, 181
BsmI GAATGC 4 cut(s) 121, 217, 250, 304
BspACI CCGC 4 cut(s) 96, 216, 225, 275
BspCNI CTCAG 2 cut(s) 58, 193
BspDI ATCGAT 2 cut(s) 107, 236
BsrFI RCCGGY 1 cut(s) 23
BsrI ACTGG 1 cut(s) 310
BssAI RCCGGY 1 cut(s) 23
BssECI CCNNGG 4 cut(s) 33, 99, 168, 228
BssNI GRCGYC 1 cut(s) 288
BssT1I CCWWGG 4 cut(s) 33, 99, 168, 228
Bst4CI ACNGT 2 cut(s) 93, 222
BstACI GRCGYC 1 cut(s) 288
BstC8I GCNNGC 4 cut(s) 58, 121, 187, 250
BstDEI CTNAG 2 cut(s) 45, 180
BstMWI GCNNNNNNNGC 9 cut(s) 29, 95, 164, 212, 224, 254, 278, 281, 287
BstSCI CCNGG 2 cut(s) 77, 206
BstV1I GCAGC 2 cut(s) 259, 268
Bsu15I ATCGAT 2 cut(s) 107, 236
BsuTUI ATCGAT 2 cut(s) 107, 236
Cac8I GCNNGC 4 cut(s) 58, 121, 187, 250
Cfr10I RCCGGY 1 cut(s) 23
Cfr13I GGNCC 2 cut(s) 37, 172
ClaI ATCGAT 2 cut(s) 107, 236
CseI GACGC 1 cut(s) 296
CviAII CATG 3 cut(s) 64, 193, 310
DdeI CTNAG 2 cut(s) 45, 180
EaeI YGGCCR 3 cut(s) 30, 121, 250
EciI GGCGGA 2 cut(s) 85, 214
Eco130I CCWWGG 4 cut(s) 33, 99, 168, 228
EcoT14I CCWWGG 4 cut(s) 33, 99, 168, 228
ErhI CCWWGG 4 cut(s) 33, 99, 168, 228
FaeI CATG 3 cut(s) 67, 196, 313
FaiI YATR 3 cut(s) 65, 194, 311
FatI CATG 3 cut(s) 63, 192, 309
FauI CCCGC 1 cut(s) 268
Fnu4HI GCNGC 3 cut(s) 216, 273, 282
Fsp4HI GCNGC 3 cut(s) 216, 273, 282
GluI GCNGC 3 cut(s) 216, 273, 282
GsaI CCCAGC 1 cut(s) 162
HapII CCGG 3 cut(s) 24, 78, 207
HgaI GACGC 1 cut(s) 296
Hin1I GRCGYC 1 cut(s) 288
Hin1II CATG 3 cut(s) 67, 196, 313
HinfI GANTC 2 cut(s) 104, 233
HpaII CCGG 3 cut(s) 24, 78, 207
Hpy188I TCNGA 1 cut(s) 264
Hpy188III TCNNGA 2 cut(s) 47, 295
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 93, 222
HpyCH4V TGCA 2 cut(s) 89, 241
HpyF10VI GCNNNNNNNGC 9 cut(s) 29, 95, 164, 212, 224, 254, 278, 281, 287
HpyF3I CTNAG 2 cut(s) 45, 180
Hsp92I GRCGYC 1 cut(s) 288
Hsp92II CATG 3 cut(s) 67, 196, 313
LmnI GCTCC 1 cut(s) 278
Lsp1109I GCAGC 2 cut(s) 259, 268
LweI GCATC 1 cut(s) 228
MboII GAAGA 1 cut(s) 154
MlsI TGGCCA 3 cut(s) 32, 123, 252
MluNI TGGCCA 3 cut(s) 32, 123, 252
MnlI CCTC 1 cut(s) 157
Mox20I TGGCCA 3 cut(s) 32, 123, 252
MscI TGGCCA 3 cut(s) 32, 123, 252
MslI CAYNNNNRTG 2 cut(s) 65, 194
Msp20I TGGCCA 3 cut(s) 32, 123, 252
MspI CCGG 3 cut(s) 24, 78, 207
MspR9I CCNGG 2 cut(s) 79, 208
Mva1269I GAATGC 4 cut(s) 121, 217, 250, 304
MwoI GCNNNNNNNGC 9 cut(s) 29, 95, 164, 212, 224, 254, 278, 281, 287
NciI CCSGG 2 cut(s) 79, 208
NlaIII CATG 3 cut(s) 67, 196, 313
PctI GAATGC 4 cut(s) 121, 217, 250, 304
PfeI GAWTC 2 cut(s) 104, 233
PflFI GACNNNGTC 1 cut(s) 290
PkrI GCNGC 3 cut(s) 217, 274, 283
PspFI CCCAGC 1 cut(s) 158
PspPI GGNCC 2 cut(s) 37, 172
PsyI GACNNNGTC 1 cut(s) 290
RseI CAYNNNNRTG 2 cut(s) 65, 194
SatI GCNGC 3 cut(s) 216, 273, 282
Sau96I GGNCC 2 cut(s) 37, 172
ScrFI CCNGG 2 cut(s) 79, 208
SetI ASST 4 cut(s) 17, 152, 259, 283
SfaNI GCATC 1 cut(s) 228
SgrAI CRCCGGYG 1 cut(s) 23
SmiMI CAYNNNNRTG 2 cut(s) 65, 194
SsiI CCGC 4 cut(s) 96, 216, 225, 275
StyD4I CCNGG 2 cut(s) 77, 206
StyI CCWWGG 4 cut(s) 33, 99, 168, 228
TaaI ACNGT 2 cut(s) 93, 222
TaqI TCGA 2 cut(s) 107, 236
TauI GCSGC 1 cut(s) 218
TfiI GAWTC 2 cut(s) 104, 233
TseI GCWGC 2 cut(s) 272, 281
Tth111I GACNNNGTC 1 cut(s) 290
XcmI CCANNNNNNNNNTGG 2 cut(s) 64, 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.