Rh2BG584800

Stress-induced protein KIN2-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
80065498 .. 80068945
3448 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG584800.1

Sequence Viewer

Length: 327 bp
ATGGATAAGATGAGCTACAACGCCGGTGTGGCCAAGGGCCAAACTCAGGAGAAGGCCAGCACCATGATGGACAAGGCCGGGAATGCTGCACAGTCCGCCAAGGAATCGATACAGAATGCTGGCCAAGTGGATAACTCGCAGAAGATGAGCTACCACGCTGGGGAGGCCAAGGGCCAAACTCAGGAGAAGACCAGCACCATGATGGACAAGGCCGGGAATGTTGCACAGTCCGCCAAGGAATCGATGCAGAATGCTGGCCAAGCTATTCAGCAAACGGCTGCGGGAGCTGCTGACGCCGTCAAGAATGCTACTGGCATGAACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

11.18

Weight (kDa)

8.89

Isoelectric Point (pI)

32.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 96, 231, 281
AcoI YGGCCR 3 cut(s) 30, 121, 256
AcyI GRCGYC 1 cut(s) 294
AfiI CCNNNNNNNGG 3 cut(s) 46, 160, 181
AluBI AGCT 4 cut(s) 15, 150, 263, 287
AluI AGCT 4 cut(s) 15, 150, 263, 287
AoxI GGCC 9 cut(s) 30, 37, 54, 75, 121, 165, 172, 210, 256
ApeKI GCWGC 3 cut(s) 86, 278, 287
AspS9I GGNCC 2 cut(s) 37, 172
AsuC2I CCSGG 2 cut(s) 79, 214
BalI TGGCCA 3 cut(s) 32, 123, 258
BarI GAAGNNNNNNTAC 2 cut(s) 134, 166
BbsI GAAGAC 1 cut(s) 194
BbvI GCAGC 3 cut(s) 73, 265, 274
BccI CCATC 2 cut(s) 61, 196
BceAI ACGGC 2 cut(s) 281, 291
BcnI CCSGG 2 cut(s) 79, 214
BglI GCCNNNNNGGC 1 cut(s) 29
BisI GCNGC 3 cut(s) 87, 279, 288
BlsI GCNGC 3 cut(s) 88, 280, 289
Bme1390I CCNGG 2 cut(s) 79, 214
BmgT120I GGNCC 2 cut(s) 37, 172
BmrFI CCNGG 2 cut(s) 79, 214
BmsI GCATC 1 cut(s) 234
BpiI GAAGAC 1 cut(s) 194
BpuMI CCSGG 2 cut(s) 79, 214
Bsa29I ATCGAT 2 cut(s) 107, 242
BsaHI GRCGYC 1 cut(s) 294
BsaJI CCNNGG 4 cut(s) 33, 99, 168, 234
Bsc4I CCNNNNNNNGG 3 cut(s) 46, 160, 181
Bse118I RCCGGY 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 316
BseCI ATCGAT 2 cut(s) 107, 242
BseDI CCNNGG 4 cut(s) 33, 99, 168, 234
BseLI CCNNNNNNNGG 3 cut(s) 46, 160, 181
BseMII CTCAG 2 cut(s) 59, 194
BseNI ACTGG 1 cut(s) 316
BseXI GCAGC 3 cut(s) 73, 265, 274
BseYI CCCAGC 1 cut(s) 158
BsgI GTGCAG 1 cut(s) 72
BshFI GGCC 9 cut(s) 32, 39, 56, 77, 123, 167, 174, 212, 258
BshVI ATCGAT 2 cut(s) 107, 242
BsiSI CCGG 3 cut(s) 24, 78, 213
BslI CCNNNNNNNGG 3 cut(s) 46, 160, 181
BsmI GAATGC 4 cut(s) 88, 121, 256, 310
BsnI GGCC 9 cut(s) 32, 39, 56, 77, 123, 167, 174, 212, 258
BspACI CCGC 3 cut(s) 96, 231, 281
BspANI GGCC 9 cut(s) 32, 39, 56, 77, 123, 167, 174, 212, 258
BspCNI CTCAG 2 cut(s) 58, 193
BspDI ATCGAT 2 cut(s) 107, 242
BsrFI RCCGGY 1 cut(s) 23
BsrI ACTGG 1 cut(s) 316
BssAI RCCGGY 1 cut(s) 23
BssECI CCNNGG 4 cut(s) 33, 99, 168, 234
BssNI GRCGYC 1 cut(s) 294
BssT1I CCWWGG 4 cut(s) 33, 99, 168, 234
Bst4CI ACNGT 2 cut(s) 93, 228
BstACI GRCGYC 1 cut(s) 294
BstC8I GCNNGC 3 cut(s) 58, 121, 256
BstDEI CTNAG 2 cut(s) 45, 180
BstMWI GCNNNNNNNGC 9 cut(s) 29, 83, 95, 164, 230, 260, 284, 287, 293
BstSCI CCNGG 2 cut(s) 77, 212
BstV1I GCAGC 3 cut(s) 73, 265, 274
BstV2I GAAGAC 1 cut(s) 194
Bsu15I ATCGAT 2 cut(s) 107, 242
BsuRI GGCC 9 cut(s) 32, 39, 56, 77, 123, 167, 174, 212, 258
BsuTUI ATCGAT 2 cut(s) 107, 242
Cac8I GCNNGC 3 cut(s) 58, 121, 256
Cfr10I RCCGGY 1 cut(s) 23
Cfr13I GGNCC 2 cut(s) 37, 172
ClaI ATCGAT 2 cut(s) 107, 242
CseI GACGC 1 cut(s) 302
CviAII CATG 3 cut(s) 64, 199, 316
DdeI CTNAG 2 cut(s) 45, 180
EaeI YGGCCR 3 cut(s) 30, 121, 256
EciI GGCGGA 2 cut(s) 85, 220
Eco130I CCWWGG 4 cut(s) 33, 99, 168, 234
EcoT14I CCWWGG 4 cut(s) 33, 99, 168, 234
ErhI CCWWGG 4 cut(s) 33, 99, 168, 234
FaeI CATG 3 cut(s) 67, 202, 319
FaiI YATR 3 cut(s) 65, 200, 317
FatI CATG 3 cut(s) 63, 198, 315
FauI CCCGC 1 cut(s) 274
Fnu4HI GCNGC 3 cut(s) 87, 279, 288
Fsp4HI GCNGC 3 cut(s) 87, 279, 288
GluI GCNGC 3 cut(s) 87, 279, 288
GsaI CCCAGC 1 cut(s) 162
HaeIII GGCC 9 cut(s) 32, 39, 56, 77, 123, 167, 174, 212, 258
HapII CCGG 3 cut(s) 24, 78, 213
HgaI GACGC 1 cut(s) 302
Hin1I GRCGYC 1 cut(s) 294
Hin1II CATG 3 cut(s) 67, 202, 319
HinfI GANTC 2 cut(s) 104, 239
HpaII CCGG 3 cut(s) 24, 78, 213
Hpy188III TCNNGA 3 cut(s) 47, 182, 301
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 93, 228
HpyCH4V TGCA 3 cut(s) 89, 224, 247
HpyF10VI GCNNNNNNNGC 9 cut(s) 29, 83, 95, 164, 230, 260, 284, 287, 293
HpyF3I CTNAG 2 cut(s) 45, 180
Hsp92I GRCGYC 1 cut(s) 294
Hsp92II CATG 3 cut(s) 67, 202, 319
LmnI GCTCC 1 cut(s) 284
Lsp1109I GCAGC 3 cut(s) 73, 265, 274
LweI GCATC 1 cut(s) 234
MboII GAAGA 2 cut(s) 154, 199
MlsI TGGCCA 3 cut(s) 32, 123, 258
MluNI TGGCCA 3 cut(s) 32, 123, 258
MnlI CCTC 1 cut(s) 157
Mox20I TGGCCA 3 cut(s) 32, 123, 258
MscI TGGCCA 3 cut(s) 32, 123, 258
MslI CAYNNNNRTG 2 cut(s) 65, 200
Msp20I TGGCCA 3 cut(s) 32, 123, 258
MspI CCGG 3 cut(s) 24, 78, 213
MspR9I CCNGG 2 cut(s) 79, 214
Mva1269I GAATGC 4 cut(s) 88, 121, 256, 310
MwoI GCNNNNNNNGC 9 cut(s) 29, 83, 95, 164, 230, 260, 284, 287, 293
NciI CCSGG 2 cut(s) 79, 214
NlaIII CATG 3 cut(s) 67, 202, 319
PctI GAATGC 4 cut(s) 88, 121, 256, 310
PfeI GAWTC 2 cut(s) 104, 239
PflFI GACNNNGTC 1 cut(s) 296
PkrI GCNGC 3 cut(s) 88, 280, 289
PspFI CCCAGC 1 cut(s) 158
PspPI GGNCC 2 cut(s) 37, 172
PsyI GACNNNGTC 1 cut(s) 296
RseI CAYNNNNRTG 2 cut(s) 65, 200
SatI GCNGC 3 cut(s) 87, 279, 288
Sau96I GGNCC 2 cut(s) 37, 172
ScrFI CCNGG 2 cut(s) 79, 214
SetI ASST 4 cut(s) 17, 152, 265, 289
SfaNI GCATC 1 cut(s) 234
SgrAI CRCCGGYG 1 cut(s) 23
SmiMI CAYNNNNRTG 2 cut(s) 65, 200
SsiI CCGC 3 cut(s) 96, 231, 281
StyD4I CCNGG 2 cut(s) 77, 212
StyI CCWWGG 4 cut(s) 33, 99, 168, 234
TaaI ACNGT 2 cut(s) 93, 228
TaqI TCGA 2 cut(s) 107, 242
TfiI GAWTC 2 cut(s) 104, 239
TseI GCWGC 3 cut(s) 86, 278, 287
Tth111I GACNNNGTC 1 cut(s) 296
XcmI CCANNNNNNNNNTGG 2 cut(s) 64, 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.