Prupe.1G014300_v2.0.a1

prefoldin subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
1055755 .. 1058371
2617 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G014300.1

Sequence Viewer

Length: 450 bp
ATGGCCAGTAGTAAAGCTGAAGGAGATCAAAAGGAATATGTAAATGAGCAAGCAGTTGCAAATAAGTTTGCTGCTATGAGGTCAGAACTCAACCAAATTTACTCGAAAATCACTGAGCTAGAGATGGAAGCAAGCGAGCACTCGTTGGTCATCAGTGCCATCCAGCCCCTTGATCCATCCAGGCGATGCTACCGGATGATCGGAGGTGTGCTGGTGGAGAGAACAATCAAGGAGGTCCTGCCTGCTGTGCAGCGCAACAAAGAGGGGATTGAGGAGGTTATTGCTAGGCTGAATGAGGCATTGGAAAAGAAGAAAAAGGAAATTTCTGATTTTGAGGCCAAGTACAAGATCAAGATACGGAAGGAGCAGGGTGAGGAGAAGGACGATGGTGCTCGGAAAGAAGGGACTGCTCAAGGAGTCCTGGTTGGCCCTGCCGGTGGAAGTGAATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

150

Amino Acids

16.58

Weight (kDa)

5.7

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 167
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 96, 321
AcuI CTGAAG 1 cut(s) 39
AfaI GTAC 1 cut(s) 344
AfiI CCNNNNNNNGG 1 cut(s) 437
AjnI CCWGG 2 cut(s) 179, 420
AjuI GAANNNNNNNTTGG 2 cut(s) 284, 316
AluBI AGCT 2 cut(s) 17, 118
AluI AGCT 2 cut(s) 17, 118
Alw21I GWGCWC 2 cut(s) 141, 394
AlwI GGATC 1 cut(s) 167
AoxI GGCC 3 cut(s) 3, 336, 427
ApeKI GCWGC 2 cut(s) 71, 250
ApoI RAATTY 2 cut(s) 96, 321
AspLEI GCGC 1 cut(s) 255
AspS9I GGNCC 2 cut(s) 235, 428
AsuHPI GGTGA 1 cut(s) 383
AvaII GGWCC 1 cut(s) 235
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 2 cut(s) 141, 394
BbvI GCAGC 2 cut(s) 58, 262
BccI CCATC 4 cut(s) 118, 167, 184, 380
BciT130I CCWGG 2 cut(s) 181, 422
BfaI CTAG 2 cut(s) 119, 285
BisI GCNGC 2 cut(s) 72, 251
BlsI GCNGC 2 cut(s) 73, 252
Bme1390I CCNGG 2 cut(s) 181, 422
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 2 cut(s) 235, 428
BmrFI CCNGG 2 cut(s) 181, 422
BmsI GCATC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 396
BsaWI WCCGGW 1 cut(s) 192
BsaXI ACNNNNNCTCC 2 cut(s) 408, 438
Bsc4I CCNNNNNNNGG 1 cut(s) 437
Bse118I RCCGGY 1 cut(s) 434
Bse1I ACTGG 1 cut(s) 6
BseBI CCWGG 2 cut(s) 181, 422
BseGI GGATG 3 cut(s) 159, 176, 201
BseLI CCNNNNNNNGG 1 cut(s) 437
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 6
BseRI GAGGAG 2 cut(s) 287, 389
BseXI GCAGC 2 cut(s) 58, 262
BsgI GTGCAG 1 cut(s) 269
BshFI GGCC 3 cut(s) 5, 338, 429
BsiHKAI GWGCWC 2 cut(s) 141, 394
BsiSI CCGG 2 cut(s) 193, 435
BslFI GGGAC 1 cut(s) 418
BslI CCNNNNNNNGG 1 cut(s) 437
BsmFI GGGAC 1 cut(s) 418
BsnI GGCC 3 cut(s) 5, 338, 429
Bsp1286I GDGCHC 2 cut(s) 141, 394
Bsp143I GATC 4 cut(s) 25, 172, 198, 348
BspANI GGCC 3 cut(s) 5, 338, 429
BspCNI CTCAG 1 cut(s) 106
BspPI GGATC 1 cut(s) 167
BsrFI RCCGGY 1 cut(s) 434
BsrI ACTGG 1 cut(s) 6
BssAI RCCGGY 1 cut(s) 434
BssMI GATC 4 cut(s) 25, 172, 198, 348
Bst2UI CCWGG 2 cut(s) 181, 422
BstC8I GCNNGC 4 cut(s) 51, 133, 137, 243
BstDEI CTNAG 1 cut(s) 114
BstF5I GGATG 3 cut(s) 159, 176, 201
BstHHI GCGC 1 cut(s) 255
BstKTI GATC 4 cut(s) 28, 175, 201, 351
BstMBI GATC 4 cut(s) 25, 172, 198, 348
BstMWI GCNNNNNNNGC 1 cut(s) 247
BstNI CCWGG 2 cut(s) 181, 422
BstSCI CCNGG 2 cut(s) 179, 420
BstV1I GCAGC 2 cut(s) 58, 262
BsuRI GGCC 3 cut(s) 5, 338, 429
BtgZI GCGATG 1 cut(s) 199
BtsCI GGATG 3 cut(s) 159, 176, 201
BtsIMutI CAGTG 2 cut(s) 111, 160
Cac8I GCNNGC 4 cut(s) 51, 133, 137, 243
CfoI GCGC 1 cut(s) 255
Cfr10I RCCGGY 1 cut(s) 434
Cfr13I GGNCC 2 cut(s) 235, 428
Csp6I GTAC 1 cut(s) 343
CviJI RGCY 7 cut(s) 5, 17, 118, 166, 289, 338, 429
CviKI_1 RGCY 7 cut(s) 5, 17, 118, 166, 289, 338, 429
CviQI GTAC 1 cut(s) 343
DdeI CTNAG 1 cut(s) 114
DpnI GATC 4 cut(s) 27, 174, 200, 350
DpnII GATC 4 cut(s) 25, 172, 198, 348
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 235
Eco57I CTGAAG 1 cut(s) 39
EcoO109I RGGNCCY 1 cut(s) 235
EcoRII CCWGG 2 cut(s) 179, 420
FaiI YATR 2 cut(s) 39, 77
FaqI GGGAC 1 cut(s) 418
Fnu4HI GCNGC 2 cut(s) 72, 251
FokI GGATG 3 cut(s) 146, 163, 208
Fsp4HI GCNGC 2 cut(s) 72, 251
FspBI CTAG 2 cut(s) 119, 285
GlaI GCGC 1 cut(s) 254
GluI GCNGC 2 cut(s) 72, 251
HaeIII GGCC 3 cut(s) 5, 338, 429
HapII CCGG 2 cut(s) 193, 435
HhaI GCGC 1 cut(s) 255
Hin6I GCGC 1 cut(s) 253
HinP1I GCGC 1 cut(s) 253
HinfI GANTC 1 cut(s) 417
HpaII CCGG 2 cut(s) 193, 435
HphI GGTGA 1 cut(s) 383
Hpy188I TCNGA 4 cut(s) 85, 203, 328, 396
Hpy188III TCNNGA 1 cut(s) 352
HpyAV CCTTC 4 cut(s) 14, 355, 373, 395
HpyCH4V TGCA 2 cut(s) 59, 250
HpyF10VI GCNNNNNNNGC 1 cut(s) 247
HpyF3I CTNAG 1 cut(s) 114
HspAI GCGC 1 cut(s) 253
Kzo9I GATC 4 cut(s) 25, 172, 198, 348
LmnI GCTCC 1 cut(s) 364
Lsp1109I GCAGC 2 cut(s) 58, 262
LweI GCATC 1 cut(s) 176
MaeI CTAG 2 cut(s) 119, 285
MalI GATC 4 cut(s) 27, 174, 200, 350
MboI GATC 4 cut(s) 25, 172, 198, 348
MboII GAAGA 1 cut(s) 322
MhlI GDGCHC 2 cut(s) 141, 394
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 96, 321
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 426
MnlI CCTC 9 cut(s) 72, 197, 226, 256, 265, 268, 289, 328, 367
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 2 cut(s) 193, 435
MspR9I CCNGG 2 cut(s) 181, 422
MvaI CCWGG 2 cut(s) 181, 422
MwoI GCNNNNNNNGC 1 cut(s) 247
NdeII GATC 4 cut(s) 25, 172, 198, 348
PkrI GCNGC 2 cut(s) 73, 252
PleI GAGTC 1 cut(s) 425
PpsI GAGTC 1 cut(s) 425
PpuMI RGGWCCY 1 cut(s) 235
Psp5II RGGWCCY 1 cut(s) 235
Psp6I CCWGG 2 cut(s) 179, 420
PspGI CCWGG 2 cut(s) 179, 420
PspPI GGNCC 2 cut(s) 235, 428
PspPPI RGGWCCY 1 cut(s) 235
RsaI GTAC 1 cut(s) 344
RsaNI GTAC 1 cut(s) 343
SatI GCNGC 2 cut(s) 72, 251
Sau3AI GATC 4 cut(s) 25, 172, 198, 348
Sau96I GGNCC 2 cut(s) 235, 428
SchI GAGTC 1 cut(s) 426
ScrFI CCNGG 2 cut(s) 181, 422
SduI GDGCHC 2 cut(s) 141, 394
SetI ASST 6 cut(s) 19, 83, 120, 208, 237, 279
SfaNI GCATC 1 cut(s) 176
SinI GGWCC 1 cut(s) 235
SmlI CTYRAG 1 cut(s) 411
SmoI CTYRAG 1 cut(s) 411
Sse9I AATT 2 cut(s) 96, 321
SspMI CTAG 2 cut(s) 119, 285
StyD4I CCNGG 2 cut(s) 179, 420
TaqI TCGA 1 cut(s) 104
TasI AATT 2 cut(s) 96, 321
TatI WGTACW 1 cut(s) 342
TscAI CASTG 2 cut(s) 118, 160
TseI GCWGC 2 cut(s) 71, 250
TspGWI ACGGA 1 cut(s) 373
TspRI CASTG 2 cut(s) 118, 160
VpaK11BI GGWCC 1 cut(s) 235
XapI RAATTY 2 cut(s) 96, 321
XspI CTAG 2 cut(s) 119, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.