Prupe.3G177500_v2.0.a1

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
19444270 .. 19444578
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G177500.1

Sequence Viewer

Length: 309 bp
ATGGGAAGCTGCTGTTGCTCATCAGCCTATGTGAGCTTAAGCTGCAGTGAGACAGTGGAGAGAGACAGGGTTAGAAAAGGTTATGTCCCAATTCTGGTGGGGAAAGAAATGGGAGACATGGAGAAGCTATGGATACCCATCAAGCTCCTCAGCCATCCAAGAATTGTTGCACTTCTCAGAAGGTCAGCCCATGAATTTGGGTTTCAACAACAAGGCTTGCTTAAGATTAAACATGATGTTCATCTTTTTAAAGGTATGATAAAGAGCATATTATCAAAATCAAAACAAAGAACATTTCTATGTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.61

Weight (kDa)

9.67

Isoelectric Point (pI)

32.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 94
AflII CTTAAG 2 cut(s) 37, 221
AgsI TTSAA 1 cut(s) 206
AluBI AGCT 5 cut(s) 9, 36, 42, 127, 145
AluI AGCT 5 cut(s) 9, 36, 42, 127, 145
Alw26I GTCTC 3 cut(s) 44, 57, 108
ApeKI GCWGC 2 cut(s) 9, 42
ApoI RAATTY 1 cut(s) 194
BbvCI CCTCAGC 1 cut(s) 149
BbvI GCAGC 1 cut(s) 29
BccI CCATC 2 cut(s) 146, 162
BciVI GTATCC 1 cut(s) 126
BcoDI GTCTC 3 cut(s) 44, 57, 108
BfmI CTRYAG 1 cut(s) 43
BfrI CTTAAG 2 cut(s) 37, 221
BfuI GTATCC 1 cut(s) 126
BisI GCNGC 2 cut(s) 10, 43
BlsI GCNGC 2 cut(s) 11, 44
Bpu10I CCTNAGC 1 cut(s) 149
BsaBI GATNNNNATC 2 cut(s) 137, 240
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse8I GATNNNNATC 2 cut(s) 137, 240
BseGI GGATG 1 cut(s) 154
BseJI GATNNNNATC 2 cut(s) 137, 240
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMII CTCAG 2 cut(s) 163, 190
BseRI GAGGAG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 29
BslFI GGGAC 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 3 cut(s) 44, 57, 108
BsmFI GGGAC 1 cut(s) 71
BspCNI CTCAG 2 cut(s) 162, 189
BspMAI CTGCAG 1 cut(s) 47
BspTI CTTAAG 2 cut(s) 37, 221
Bst4CI ACNGT 1 cut(s) 55
BstAFI CTTAAG 2 cut(s) 37, 221
BstC8I GCNNGC 1 cut(s) 218
BstDEI CTNAG 2 cut(s) 149, 176
BstF5I GGATG 1 cut(s) 154
BstMAI GTCTC 3 cut(s) 44, 57, 108
BstMWI GCNNNNNNNGC 2 cut(s) 15, 42
BstSFI CTRYAG 1 cut(s) 43
BstV1I GCAGC 1 cut(s) 29
BstXI CCANNNNNNTGG 1 cut(s) 197
BsuI GTATCC 1 cut(s) 126
BtsCI GGATG 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 52
BtsIMutI CAGTG 2 cut(s) 52, 60
Cac8I GCNNGC 1 cut(s) 218
CspCI CAANNNNNGTGG 2 cut(s) 78, 113
CviAII CATG 3 cut(s) 118, 191, 233
CviJI RGCY 9 cut(s) 9, 26, 36, 42, 127, 145, 153, 188, 216
CviKI_1 RGCY 9 cut(s) 9, 26, 36, 42, 127, 145, 153, 188, 216
DdeI CTNAG 2 cut(s) 149, 176
DraI TTTAAA 1 cut(s) 250
FaeI CATG 3 cut(s) 121, 194, 236
FaiI YATR 9 cut(s) 30, 84, 119, 130, 192, 234, 257, 269, 301
FalI AAGNNNNNCTT 2 cut(s) 204, 236
FaqI GGGAC 1 cut(s) 71
FatI CATG 3 cut(s) 117, 190, 232
Fnu4HI GCNGC 2 cut(s) 10, 43
FokI GGATG 1 cut(s) 141
Fsp4HI GCNGC 2 cut(s) 10, 43
GluI GCNGC 2 cut(s) 10, 43
Hin1II CATG 3 cut(s) 121, 194, 236
Hpy188I TCNGA 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 174
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4V TGCA 2 cut(s) 45, 170
HpyF10VI GCNNNNNNNGC 2 cut(s) 15, 42
HpyF3I CTNAG 2 cut(s) 149, 176
Hsp92II CATG 3 cut(s) 121, 194, 236
LmnI GCTCC 1 cut(s) 150
LpnPI CCDG 2 cut(s) 52, 80
Lsp1109I GCAGC 1 cut(s) 29
MluCI AATT 4 cut(s) 90, 162, 194, 304
MnlI CCTC 1 cut(s) 158
MseI TTAA 5 cut(s) 38, 222, 228, 249, 307
MslI CAYNNNNRTG 1 cut(s) 298
MspCI CTTAAG 2 cut(s) 37, 221
MwoI GCNNNNNNNGC 2 cut(s) 15, 42
NlaIII CATG 3 cut(s) 121, 194, 236
PkrI GCNGC 2 cut(s) 11, 44
PstI CTGCAG 1 cut(s) 47
RseI CAYNNNNRTG 1 cut(s) 298
SaqAI TTAA 5 cut(s) 38, 222, 228, 249, 307
SatI GCNGC 2 cut(s) 10, 43
SetI ASST 8 cut(s) 11, 38, 44, 82, 129, 147, 185, 256
SfcI CTRYAG 1 cut(s) 43
SgeI CNNG 9 cut(s) 79, 107, 130, 154, 171, 203, 224, 229, 245
SmiMI CAYNNNNRTG 1 cut(s) 298
SmlI CTYRAG 2 cut(s) 37, 221
SmoI CTYRAG 2 cut(s) 37, 221
Sse9I AATT 4 cut(s) 90, 162, 194, 304
TaaI ACNGT 1 cut(s) 55
TasI AATT 4 cut(s) 90, 162, 194, 304
Tru1I TTAA 5 cut(s) 38, 222, 228, 249, 307
Tru9I TTAA 5 cut(s) 38, 222, 228, 249, 307
TscAI CASTG 2 cut(s) 52, 60
TseI GCWGC 2 cut(s) 9, 42
TspDTI ATGAA 2 cut(s) 207, 230
TspRI CASTG 2 cut(s) 52, 60
Vha464I CTTAAG 2 cut(s) 37, 221
XapI RAATTY 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.