Rh2BG504400

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0005194
Physical Location & Seq
Reverse (-)
71004794 .. 71012074
7281 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG504400.1

Sequence Viewer

Length: 450 bp
ATGGAGAGATCAGGTAATAAGGTGATACGCAAAGGTTATGTCCCAGTGCTTGTGGGGAAACAAGGGGATGAAGATGATCTCATGGAGAAACTATGGATGCCGATCAAGCTTATCAACCATCCTCGCATCATTGCGCTACTCAACAATTCAGCCGATGAATTTGGGTTTCGCCAACAGGGCTTGCTTAAGATAATTACTCAAGATGTTCACCTTGTCAAAGGGTTTATTTACAAGACTCAAGTTATGGGAAAGCGTGGTATTGATGCATTGCCTGGCATGACAATTGGCAAAGCTACAGCCGAGCAGAAGATCTTAATAGTTCCTTTGCCAGTGAAGCTTCTTGGGAACACCCGCCTGCTTCTTATCAAGGAATGCAGAGGCCAGCAACTGAAAGAAAATATGGAACATGGCAAGAGAGAATACAAGATCCAAAAAAAGAATAAGGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

149

Amino Acids

16.93

Weight (kDa)

9.92

Isoelectric Point (pI)

28.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 4 - 64 7.6e-07 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 352
AclWI GGATC 1 cut(s) 421
AcsI RAATTY 1 cut(s) 158
AflII CTTAAG 1 cut(s) 185
AjnI CCWGG 1 cut(s) 271
AluBI AGCT 3 cut(s) 109, 293, 337
AluI AGCT 3 cut(s) 109, 293, 337
AlwI GGATC 1 cut(s) 421
AlwNI CAGNNNCTG 1 cut(s) 388
AoxI GGCC 1 cut(s) 379
ApoI RAATTY 1 cut(s) 158
ArsI GACNNNNNNTTYG 2 cut(s) 24, 56
AspLEI GCGC 1 cut(s) 136
AsuHPI GGTGA 2 cut(s) 34, 200
BccI CCATC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 273
BfmI CTRYAG 1 cut(s) 294
BfrI CTTAAG 1 cut(s) 185
BglI GCCNNNNNGGC 1 cut(s) 177
BglII AGATCT 1 cut(s) 309
Bme1390I CCNGG 1 cut(s) 273
BmrFI CCNGG 1 cut(s) 273
BmrI ACTGGG 1 cut(s) 38
BmsI GCATC 3 cut(s) 87, 135, 253
BmuI ACTGGG 1 cut(s) 38
BpuEI CTTGAG 2 cut(s) 183, 222
BsaBI GATNNNNATC 1 cut(s) 101
Bse1I ACTGG 2 cut(s) 44, 329
Bse3DI GCAATG 2 cut(s) 129, 266
Bse8I GATNNNNATC 1 cut(s) 101
BseBI CCWGG 1 cut(s) 273
BseGI GGATG 3 cut(s) 73, 102, 118
BseJI GATNNNNATC 1 cut(s) 101
BseMI GCAATG 2 cut(s) 129, 266
BseNI ACTGG 2 cut(s) 44, 329
BshFI GGCC 1 cut(s) 381
BslFI GGGAC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 26
BsmI GAATGC 1 cut(s) 377
BsnI GGCC 1 cut(s) 381
Bsp143I GATC 5 cut(s) 8, 76, 102, 309, 426
BspACI CCGC 1 cut(s) 352
BspANI GGCC 1 cut(s) 381
BspPI GGATC 1 cut(s) 421
BspTI CTTAAG 1 cut(s) 185
BsrDI GCAATG 2 cut(s) 129, 266
BsrI ACTGG 2 cut(s) 44, 329
BssMI GATC 5 cut(s) 8, 76, 102, 309, 426
Bst2UI CCWGG 1 cut(s) 273
BstAFI CTTAAG 1 cut(s) 185
BstC8I GCNNGC 3 cut(s) 182, 356, 383
BstF5I GGATG 3 cut(s) 73, 102, 118
BstHHI GCGC 1 cut(s) 136
BstKTI GATC 5 cut(s) 11, 79, 105, 312, 429
BstMBI GATC 5 cut(s) 8, 76, 102, 309, 426
BstMWI GCNNNNNNNGC 3 cut(s) 106, 177, 334
BstNI CCWGG 1 cut(s) 273
BstSCI CCNGG 1 cut(s) 271
BstSFI CTRYAG 1 cut(s) 294
BstX2I RGATCY 2 cut(s) 309, 426
BstYI RGATCY 2 cut(s) 309, 426
BsuRI GGCC 1 cut(s) 381
BtsCI GGATG 3 cut(s) 73, 102, 118
BtsIMutI CAGTG 2 cut(s) 51, 336
Cac8I GCNNGC 3 cut(s) 182, 356, 383
CaiI CAGNNNCTG 1 cut(s) 388
CfoI GCGC 1 cut(s) 136
CviAII CATG 4 cut(s) 82, 277, 407, 447
CviJI RGCY 7 cut(s) 109, 152, 180, 293, 299, 337, 381
CviKI_1 RGCY 7 cut(s) 109, 152, 180, 293, 299, 337, 381
DpnI GATC 5 cut(s) 10, 78, 104, 311, 428
DpnII GATC 5 cut(s) 8, 76, 102, 309, 426
EcoRII CCWGG 1 cut(s) 271
EcoT22I ATGCAT 1 cut(s) 268
FaeI CATG 4 cut(s) 85, 280, 410, 450
FaiI YATR 8 cut(s) 39, 83, 94, 245, 278, 401, 408, 448
FaqI GGGAC 1 cut(s) 26
FatI CATG 4 cut(s) 81, 276, 406, 446
FauI CCCGC 1 cut(s) 359
FokI GGATG 3 cut(s) 80, 105, 109
GlaI GCGC 1 cut(s) 135
HaeIII GGCC 1 cut(s) 381
HhaI GCGC 1 cut(s) 136
Hin1II CATG 4 cut(s) 85, 280, 410, 450
Hin6I GCGC 1 cut(s) 134
HinP1I GCGC 1 cut(s) 134
HindIII AAGCTT 2 cut(s) 107, 335
HinfI GANTC 1 cut(s) 235
HphI GGTGA 2 cut(s) 34, 200
Hpy166II GTNNAC 1 cut(s) 208
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 1 cut(s) 208
HpyCH4V TGCA 2 cut(s) 266, 375
HpyF10VI GCNNNNNNNGC 3 cut(s) 106, 177, 334
Hsp92II CATG 4 cut(s) 85, 280, 410, 450
HspAI GCGC 1 cut(s) 134
Kzo9I GATC 5 cut(s) 8, 76, 102, 309, 426
LpnPI CCDG 7 cut(s) 57, 161, 258, 285, 342, 368, 395
LweI GCATC 3 cut(s) 87, 135, 253
MalI GATC 5 cut(s) 10, 78, 104, 311, 428
MboI GATC 5 cut(s) 8, 76, 102, 309, 426
MboII GAAGA 2 cut(s) 83, 319
MfeI CAATTG 1 cut(s) 282
MflI RGATCY 2 cut(s) 309, 426
MluCI AATT 4 cut(s) 145, 158, 192, 282
MlyI GAGTC 1 cut(s) 229
MnlI CCTC 2 cut(s) 132, 371
Mph1103I ATGCAT 1 cut(s) 268
MseI TTAA 2 cut(s) 186, 314
MspCI CTTAAG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 273
MunI CAATTG 1 cut(s) 282
Mva1269I GAATGC 1 cut(s) 377
MvaI CCWGG 1 cut(s) 273
MwoI GCNNNNNNNGC 3 cut(s) 106, 177, 334
NdeII GATC 5 cut(s) 8, 76, 102, 309, 426
NlaIII CATG 4 cut(s) 85, 280, 410, 450
NmeAIII GCCGAG 1 cut(s) 325
NsiI ATGCAT 1 cut(s) 268
PctI GAATGC 1 cut(s) 377
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
Psp6I CCWGG 1 cut(s) 271
PspGI CCWGG 1 cut(s) 271
PstNI CAGNNNCTG 1 cut(s) 388
PsuI RGATCY 2 cut(s) 309, 426
SaqAI TTAA 2 cut(s) 186, 314
Sau3AI GATC 5 cut(s) 8, 76, 102, 309, 426
SchI GAGTC 1 cut(s) 229
ScrFI CCNGG 1 cut(s) 273
SetI ASST 7 cut(s) 16, 24, 37, 111, 213, 295, 339
SfaNI GCATC 3 cut(s) 87, 135, 253
SfcI CTRYAG 1 cut(s) 294
SmlI CTYRAG 3 cut(s) 185, 198, 237
SmoI CTYRAG 3 cut(s) 185, 198, 237
Sse9I AATT 4 cut(s) 145, 158, 192, 282
SsiI CCGC 1 cut(s) 352
StyD4I CCNGG 1 cut(s) 271
TasI AATT 4 cut(s) 145, 158, 192, 282
Tru1I TTAA 2 cut(s) 186, 314
Tru9I TTAA 2 cut(s) 186, 314
TscAI CASTG 2 cut(s) 51, 336
TspDTI ATGAA 2 cut(s) 84, 171
TspRI CASTG 2 cut(s) 51, 336
Vha464I CTTAAG 1 cut(s) 185
XapI RAATTY 1 cut(s) 158
Zsp2I ATGCAT 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.