Rh2BG504300

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
71001029 .. 71002624
1596 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG504300.1

Sequence Viewer

Length: 327 bp
ATGTGTGACTGGATACACAACAAGCTCAAGTTGAAAATGAGTTCTTGGAAATCAAAAATGAGTATAAGTAGCAGCAGCTGCAGTTGTTCTTCATCAGCCAAAATCCGGAAAGGTTATGTTCCGATGATTATTGTGGCGAAACACGGGGATGATGATCATGAGCAGAAAGTATGGATAACAATTAAGCTAATGAACCATCCTCGAATTGTTGCACTACTCGAAGACCAAGCAGATGAATTTGGGTTTCACCAACAAGGCTTGCTTAAGATTAGATACGATCTCCATCTTTTTAAAGGTATGATTGAGAGTTTATCAAACCACAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.46

Weight (kDa)

9.22

Isoelectric Point (pI)

48.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 14 - 103 3.6e-10 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 105
AcsI RAATTY 1 cut(s) 236
AfiI CCNNNNNNNGG 1 cut(s) 105
AflII CTTAAG 1 cut(s) 263
AgsI TTSAA 1 cut(s) 34
AluBI AGCT 3 cut(s) 25, 78, 187
AluI AGCT 3 cut(s) 25, 78, 187
AlwNI CAGNNNCTG 1 cut(s) 78
Aor13HI TCCGGA 1 cut(s) 105
ApeKI GCWGC 3 cut(s) 72, 75, 78
ApoI RAATTY 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 239
BbsI GAAGAC 1 cut(s) 228
BbvI GCAGC 3 cut(s) 65, 84, 87
BccI CCATC 2 cut(s) 204, 291
BciVI GTATCC 1 cut(s) 6
BclI TGATCA 1 cut(s) 154
BfmI CTRYAG 1 cut(s) 79
BfrI CTTAAG 1 cut(s) 263
BfuI GTATCC 1 cut(s) 6
BisI GCNGC 3 cut(s) 73, 76, 79
BlsI GCNGC 3 cut(s) 74, 77, 80
BpiI GAAGAC 1 cut(s) 228
BpuEI CTTGAG 1 cut(s) 11
BsaBI GATNNNNATC 2 cut(s) 153, 282
BsaWI WCCGGW 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 14
Bse8I GATNNNNATC 2 cut(s) 153, 282
BseAI TCCGGA 1 cut(s) 105
BseGI GGATG 2 cut(s) 154, 196
BseJI GATNNNNATC 2 cut(s) 153, 282
BseLI CCNNNNNNNGG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 14
BseXI GCAGC 3 cut(s) 65, 84, 87
BsiSI CCGG 1 cut(s) 106
BslI CCNNNNNNNGG 1 cut(s) 105
Bsp13I TCCGGA 1 cut(s) 105
Bsp143I GATC 2 cut(s) 154, 277
BspEI TCCGGA 1 cut(s) 105
BspHI TCATGA 1 cut(s) 157
BspMAI CTGCAG 1 cut(s) 83
BspTI CTTAAG 1 cut(s) 263
BsrI ACTGG 1 cut(s) 14
BssMI GATC 2 cut(s) 154, 277
BstAFI CTTAAG 1 cut(s) 263
BstAPI GCANNNNNTGC 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 260
BstF5I GGATG 2 cut(s) 154, 196
BstKTI GATC 2 cut(s) 157, 280
BstMBI GATC 2 cut(s) 154, 277
BstMWI GCNNNNNNNGC 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 79
BstV1I GCAGC 3 cut(s) 65, 84, 87
BstV2I GAAGAC 1 cut(s) 228
BsuI GTATCC 1 cut(s) 6
BtsCI GGATG 2 cut(s) 154, 196
Cac8I GCNNGC 1 cut(s) 260
CaiI CAGNNNCTG 1 cut(s) 78
CciI TCATGA 1 cut(s) 157
CviAII CATG 1 cut(s) 158
CviJI RGCY 5 cut(s) 25, 78, 98, 187, 258
CviKI_1 RGCY 5 cut(s) 25, 78, 98, 187, 258
DpnI GATC 2 cut(s) 156, 279
DpnII GATC 2 cut(s) 154, 277
DraI TTTAAA 1 cut(s) 292
FaeI CATG 1 cut(s) 161
FaiI YATR 5 cut(s) 65, 117, 159, 172, 299
FalI AAGNNNNNCTT 2 cut(s) 246, 278
FatI CATG 1 cut(s) 157
FbaI TGATCA 1 cut(s) 154
Fnu4HI GCNGC 3 cut(s) 73, 76, 79
FokI GGATG 2 cut(s) 161, 183
Fsp4HI GCNGC 3 cut(s) 73, 76, 79
GluI GCNGC 3 cut(s) 73, 76, 79
HapII CCGG 1 cut(s) 106
Hin1II CATG 1 cut(s) 161
HpaII CCGG 1 cut(s) 106
HphI GGTGA 1 cut(s) 239
Hpy188I TCNGA 1 cut(s) 123
Hpy188III TCNNGA 2 cut(s) 106, 158
HpyCH4V TGCA 2 cut(s) 81, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
Hsp92II CATG 1 cut(s) 161
Kpn2I TCCGGA 1 cut(s) 105
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 2 cut(s) 154, 277
LpnPI CCDG 1 cut(s) 119
Lsp1109I GCAGC 3 cut(s) 65, 84, 87
MaeIII GTNAC 1 cut(s) 5
MalI GATC 2 cut(s) 156, 279
MboI GATC 2 cut(s) 154, 277
MboII GAAGA 2 cut(s) 81, 233
MluCI AATT 3 cut(s) 180, 204, 236
MnlI CCTC 1 cut(s) 210
MroI TCCGGA 1 cut(s) 105
MseI TTAA 3 cut(s) 183, 264, 291
MslI CAYNNNNRTG 1 cut(s) 147
MspA1I CMGCKG 1 cut(s) 78
MspCI CTTAAG 1 cut(s) 263
MspI CCGG 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 78
NdeII GATC 2 cut(s) 154, 277
NlaIII CATG 1 cut(s) 161
NmuCI GTSAC 1 cut(s) 5
PagI TCATGA 1 cut(s) 157
PkrI GCNGC 3 cut(s) 74, 77, 80
PstI CTGCAG 1 cut(s) 83
PstNI CAGNNNCTG 1 cut(s) 78
PvuII CAGCTG 1 cut(s) 78
RseI CAYNNNNRTG 1 cut(s) 147
SaqAI TTAA 3 cut(s) 183, 264, 291
SatI GCNGC 3 cut(s) 73, 76, 79
Sau3AI GATC 2 cut(s) 154, 277
SetI ASST 5 cut(s) 27, 80, 115, 189, 298
SfcI CTRYAG 1 cut(s) 79
SmiMI CAYNNNNRTG 1 cut(s) 147
SmlI CTYRAG 2 cut(s) 26, 263
SmoI CTYRAG 2 cut(s) 26, 263
Sse9I AATT 3 cut(s) 180, 204, 236
TaqI TCGA 2 cut(s) 202, 219
TasI AATT 3 cut(s) 180, 204, 236
Tru1I TTAA 3 cut(s) 183, 264, 291
Tru9I TTAA 3 cut(s) 183, 264, 291
TseFI GTSAC 1 cut(s) 5
TseI GCWGC 3 cut(s) 72, 75, 78
Tsp45I GTSAC 1 cut(s) 5
TspDTI ATGAA 3 cut(s) 81, 206, 249
Vha464I CTTAAG 1 cut(s) 263
XapI RAATTY 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.