Rh2DG515700

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0005194
Physical Location & Seq
Reverse (-)
73935385 .. 73935803
419 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG515700.1

Sequence Viewer

Length: 258 bp
ATGGAGAGATCAGGTAATAAGGTGATACGCAAAGGTTATGTCCCAGTGCTTGTGGGGAAACAAGGGGATGAAGATGATCTCATGGAGAAACTATGGATGCCGATCAAGCTTATCAACCATCCTCGCATCATTGCGCTACTCAACAATTCAGCCGATGAATTTGGGTTTCGCCAACAGGGCTTGCTTAAGATAATTACTCAAGATGTTCACCTTGTCAAAGGCACAAGACTAGAAAAGATCGATCAGACAAAGCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

85

Amino Acids

9.78

Weight (kDa)

9.4

Isoelectric Point (pI)

27.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 4 - 64 1.5e-07 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 158
AflII CTTAAG 1 cut(s) 185
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
ApoI RAATTY 1 cut(s) 158
ArsI GACNNNNNNTTYG 2 cut(s) 24, 56
AspLEI GCGC 1 cut(s) 136
AsuHPI GGTGA 2 cut(s) 34, 200
BccI CCATC 1 cut(s) 126
BfaI CTAG 1 cut(s) 230
BfrI CTTAAG 1 cut(s) 185
BglI GCCNNNNNGGC 1 cut(s) 177
BmrI ACTGGG 1 cut(s) 38
BmsI GCATC 2 cut(s) 87, 135
BmuI ACTGGG 1 cut(s) 38
BpuEI CTTGAG 1 cut(s) 183
Bsa29I ATCGAT 1 cut(s) 240
BsaBI GATNNNNATC 1 cut(s) 101
Bse1I ACTGG 1 cut(s) 44
Bse3DI GCAATG 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 101
BseCI ATCGAT 1 cut(s) 240
BseGI GGATG 3 cut(s) 73, 102, 118
BseJI GATNNNNATC 1 cut(s) 101
BseMI GCAATG 1 cut(s) 129
BseNI ACTGG 1 cut(s) 44
BshVI ATCGAT 1 cut(s) 240
BslFI GGGAC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 26
Bsp143I GATC 5 cut(s) 8, 76, 102, 237, 241
BspDI ATCGAT 1 cut(s) 240
BspTI CTTAAG 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 129
BsrI ACTGG 1 cut(s) 44
BssMI GATC 5 cut(s) 8, 76, 102, 237, 241
BstAFI CTTAAG 1 cut(s) 185
BstC8I GCNNGC 1 cut(s) 182
BstF5I GGATG 3 cut(s) 73, 102, 118
BstHHI GCGC 1 cut(s) 136
BstKTI GATC 5 cut(s) 11, 79, 105, 240, 244
BstMBI GATC 5 cut(s) 8, 76, 102, 237, 241
BstMWI GCNNNNNNNGC 2 cut(s) 106, 177
Bsu15I ATCGAT 1 cut(s) 240
BsuTUI ATCGAT 1 cut(s) 240
BtsCI GGATG 3 cut(s) 73, 102, 118
BtsIMutI CAGTG 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 182
CfoI GCGC 1 cut(s) 136
ClaI ATCGAT 1 cut(s) 240
CviAII CATG 1 cut(s) 82
CviJI RGCY 3 cut(s) 109, 152, 180
CviKI_1 RGCY 3 cut(s) 109, 152, 180
DpnI GATC 5 cut(s) 10, 78, 104, 239, 243
DpnII GATC 5 cut(s) 8, 76, 102, 237, 241
FaeI CATG 1 cut(s) 85
FaiI YATR 3 cut(s) 39, 83, 94
FaqI GGGAC 1 cut(s) 26
FatI CATG 1 cut(s) 81
FokI GGATG 3 cut(s) 80, 105, 109
FspBI CTAG 1 cut(s) 230
GlaI GCGC 1 cut(s) 135
HhaI GCGC 1 cut(s) 136
Hin1II CATG 1 cut(s) 85
Hin6I GCGC 1 cut(s) 134
HinP1I GCGC 1 cut(s) 134
HindIII AAGCTT 1 cut(s) 107
HphI GGTGA 2 cut(s) 34, 200
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 246
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 1 cut(s) 208
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 177
Hsp92II CATG 1 cut(s) 85
HspAI GCGC 1 cut(s) 134
Kzo9I GATC 5 cut(s) 8, 76, 102, 237, 241
LpnPI CCDG 2 cut(s) 57, 161
LweI GCATC 2 cut(s) 87, 135
MaeI CTAG 1 cut(s) 230
MalI GATC 5 cut(s) 10, 78, 104, 239, 243
MboI GATC 5 cut(s) 8, 76, 102, 237, 241
MboII GAAGA 1 cut(s) 83
MluCI AATT 3 cut(s) 145, 158, 192
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 186
MspCI CTTAAG 1 cut(s) 185
MwoI GCNNNNNNNGC 2 cut(s) 106, 177
NdeII GATC 5 cut(s) 8, 76, 102, 237, 241
NlaIII CATG 1 cut(s) 85
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 5 cut(s) 8, 76, 102, 237, 241
SetI ASST 5 cut(s) 16, 24, 37, 111, 213
SfaNI GCATC 2 cut(s) 87, 135
SmlI CTYRAG 2 cut(s) 185, 198
SmoI CTYRAG 2 cut(s) 185, 198
Sse9I AATT 3 cut(s) 145, 158, 192
SspMI CTAG 1 cut(s) 230
TaqI TCGA 1 cut(s) 240
TasI AATT 3 cut(s) 145, 158, 192
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 51
TspDTI ATGAA 2 cut(s) 84, 171
TspRI CASTG 1 cut(s) 51
Vha464I CTTAAG 1 cut(s) 185
XapI RAATTY 1 cut(s) 158
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.