Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp04

Orthogroup ID

OG0008128

Physical Location & Seq

Genomic Coordinates Reverse (-)

17840339 .. 17842152

Gene Structure 1814 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.4G255600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1050 bp

ATGGATTTCCCTACACAAGCTAGAACAGTTCCAAAAACTCTTATGGCTTCCATATTGCTGCTACTTGTATTGTTGATGCCTGCCCTGCAAATAACAGGTGCACAATCTGTTGGTGTTTGTTATGGACGAAATGGCAACAATTTACCATCCGAATCAGACGTCGTTGGCTTGTACAAAAGCAATGGCATTGGAAGAATGAGAATTTATGAACCCAATGATCCAACCTATCAAGCCCTTAAAGGTTCCAACATAGAACTCACCGTGACCATCCTCAAAAGCCAGCTTCAAGGCCTCACTGATGCTGCTGCTGCAACAGATTGGGTCCAAAAGAATGTACAAGCCTACTCGCCTGACGTCAAGTTCAAATACATTGCGGTCGGGAACGAAGTACGCCCCACGGATCCAGAGACCCAGTATCTCCTCCCAGCCATCCAAAACATTCATAATGCAATTGTAGCAGCCAATCTGCAAGGCCAGATCAAAGTCTCAACAGCAATTGACACAACCCTTGTGGACAATGCCTACCCTCCTTCAGCTGGAAAATATAGTGATGCTGCAAAGTCATTCATAACCCCAGTTATCAACTTCCTAGCCAGCAATGGGGCCCCTCTTCTTGTCAATGTGTATCCTTACGTCAGCTACACTGAAAATCCTTCTCAAATAGACATTGCCTATGCCTTATTCACCTCACAAGGGATCACGACACCCGACGGTGTAAAGTACCAAAACCTGTTTGATGCTCTTTTGGATGCTCAGTACTCTGCTCTCGAGAAAGCCAATGCTCCCAACGTGGAGATCGTCGTGTCGGAGAGTGGTTGGCCATCCGAAGGCAGTGATGCCGCAACCACTCAAAATGCACAAACATTCTACCAGAATTTGATCAACCATGTGAAAGGTACTACTGGGACTCCAAAGAGGCCTGGAAAAGCTATAGAAACTTACCTTTTTGCCATGTTTGATGAAAATATCAAGGACGGTGCTGAAGTTGAGAGACACTTCGGTCTTTTCTCCCCCAACAAACAACCCAAGTACCAACTGACCTTTGGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001871 GO:0003674 GO:0003824 GO:0004553 GO:0005488 GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0016787 GO:0016798 GO:0030246 GO:0030247 GO:0031224 GO:0031225 GO:0031226 GO:0044425 GO:0044459 GO:0044464 GO:0046658 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Glyco_hydro_17

Protein Analysis

350

Amino Acids

37.9

Weight (kDa)

5.18

Isoelectric Point (pI)

36.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008128)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g11270 FvH4_3g28370 FvH4_3g28390 FvH4_4g30150
malus_domestica	MD03G1171500.v1.1 MD11G1189000.v1.1 MD12G1089500.v1.1
prunus_persica	Prupe.2G263400_v2.0.a1 Prupe.2G270100_v2.0.a1 Prupe.4G255600_v2.0.a1
pyrus_communis	pycom01g17970 pycom03g12870 pycom11g16540 pycom12g07370
rosa_chinensis	RchiOBHm_Chr5g0053361
rosa_laevigata	RLG00000034767
rosa_multiflora	Rmu_sc0001966.1_g000004
rosa_roxburghii	Rroxscaffold_1G00029090
rosa_rugosa	Rorug05G0267400
rosa_samantha	Rh5AG340000 Rh5BG350400 Rh5CG376700 Rh5DG364300
rosa_wichuraiana	Rw5G032090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	999
AatII	GACGTC	2 cut(s)	162, 357
AciI	CCGC	2 cut(s)	374, 840
AclWI	GGATC	4 cut(s)	212, 395, 408, 704
AcoI	YGGCCR	1 cut(s)	818
AcsI	RAATTY	2 cut(s)	201, 874
AcuI	CTGAAG	2 cut(s)	516, 1002
AcyI	GRCGYC	2 cut(s)	159, 354
AfaI	GTAC	7 cut(s)	173, 336, 390, 722, 758, 898, 1031
AfiI	CCNNNNNNNGG	4 cut(s)	536, 600, 693, 827
AgsI	TTSAA	2 cut(s)	287, 364
AjnI	CCWGG	1 cut(s)	919
AluBI	AGCT	5 cut(s)	20, 283, 536, 639, 929
AluI	AGCT	5 cut(s)	20, 283, 536, 639, 929
Alw21I	GWGCWC	1 cut(s)	103
Alw26I	GTCTC	3 cut(s)	401, 490, 985
Alw44I	GTGCAC	1 cut(s)	99
AlwI	GGATC	4 cut(s)	212, 395, 408, 704
Ama87I	CYCGRG	1 cut(s)	767
AoxI	GGCC	5 cut(s)	289, 472, 603, 818, 917
ApaI	GGGCCC	1 cut(s)	607
ApaLI	GTGCAC	1 cut(s)	99
ApeKI	GCWGC	6 cut(s)	58, 302, 305, 308, 458, 554
ApoI	RAATTY	2 cut(s)	201, 874
ArsI	GACNNNNNNTTYG	2 cut(s)	144, 176
AspS9I	GGNCC	3 cut(s)	322, 603, 604
AsuHPI	GGTGA	2 cut(s)	250, 676
AvaI	CYCGRG	1 cut(s)	767
AvaII	GGWCC	1 cut(s)	322
BaeGI	GKGCMC	2 cut(s)	103, 607
BaeI	ACNNNNGTAYC	2 cut(s)	1013, 1046
BalI	TGGCCA	1 cut(s)	820
BamHI	GGATCC	1 cut(s)	400
BanII	GRGCYC	1 cut(s)	607
Bbv12I	GWGCWC	1 cut(s)	103
BbvI	GCAGC	6 cut(s)	45, 289, 292, 295, 470, 541
BccI	CCATC	4 cut(s)	154, 275, 437, 829
BciT130I	CCWGG	1 cut(s)	921
BciVI	GTATCC	1 cut(s)	636
BclI	TGATCA	1 cut(s)	879
BcoDI	GTCTC	3 cut(s)	401, 490, 985
BfaI	CTAG	3 cut(s)	21, 590, 1048
BfmI	CTRYAG	1 cut(s)	930
BfuI	GTATCC	1 cut(s)	636
BisI	GCNGC	7 cut(s)	59, 303, 306, 309, 459, 555, 840
BlsI	GCNGC	7 cut(s)	60, 304, 307, 310, 460, 556, 841
BmcAI	AGTACT	1 cut(s)	758
Bme1390I	CCNGG	1 cut(s)	921
Bme18I	GGWCC	1 cut(s)	322
BmeT110I	CYCGRG	1 cut(s)	767
BmgT120I	GGNCC	3 cut(s)	322, 603, 604
BmiI	GGNNCC	6 cut(s)	244, 323, 402, 604, 605, 606
BmrFI	CCNGG	1 cut(s)	921
BmrI	ACTGGG	3 cut(s)	406, 569, 912
BmsI	GCATC	6 cut(s)	66, 289, 541, 727, 739, 826
BmuI	ACTGGG	3 cut(s)	406, 569, 912
BsaHI	GRCGYC	2 cut(s)	159, 354
BsaI	GGTCTC	1 cut(s)	401
BsaJI	CCNNGG	1 cut(s)	396
BsaXI	ACNNNNNCTCC	2 cut(s)	892, 922
Bsc4I	CCNNNNNNNGG	4 cut(s)	536, 600, 693, 827
Bse1I	ACTGG	3 cut(s)	412, 575, 907
Bse3DI	GCAATG	4 cut(s)	187, 369, 604, 666
BseBI	CCWGG	1 cut(s)	921
BseDI	CCNNGG	1 cut(s)	396
BseGI	GGATG	5 cut(s)	146, 267, 429, 754, 821
BseLI	CCNNNNNNNGG	4 cut(s)	536, 600, 693, 827
BseMI	GCAATG	4 cut(s)	187, 369, 604, 666
BseMII	CTCAG	1 cut(s)	767
BseNI	ACTGG	3 cut(s)	412, 575, 907
BseRI	GAGGAG	1 cut(s)	410
BseSI	GKGCMC	2 cut(s)	103, 607
BseXI	GCAGC	6 cut(s)	45, 289, 292, 295, 470, 541
BseYI	CCCAGC	1 cut(s)	424
Bsh1285I	CGRYCG	1 cut(s)	378
BshFI	GGCC	5 cut(s)	291, 474, 605, 820, 919
BsiEI	CGRYCG	1 cut(s)	378
BsiHKAI	GWGCWC	1 cut(s)	103
BsiHKCI	CYCGRG	1 cut(s)	767
BslFI	GGGAC	1 cut(s)	919
BslI	CCNNNNNNNGG	4 cut(s)	536, 600, 693, 827
BsmAI	GTCTC	3 cut(s)	401, 490, 985
BsmFI	GGGAC	1 cut(s)	919
BsnI	GGCC	5 cut(s)	291, 474, 605, 820, 919
Bso31I	GGTCTC	1 cut(s)	401
BsoBI	CYCGRG	1 cut(s)	767
Bsp120I	GGGCCC	1 cut(s)	603
Bsp1286I	GDGCHC	2 cut(s)	103, 607
Bsp1407I	TGTACA	2 cut(s)	171, 334
Bsp143I	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
BspACI	CCGC	2 cut(s)	374, 840
BspANI	GGCC	5 cut(s)	291, 474, 605, 820, 919
BspCNI	CTCAG	1 cut(s)	766
BspLI	GGNNCC	6 cut(s)	244, 323, 402, 604, 605, 606
BspPI	GGATC	4 cut(s)	212, 395, 408, 704
BspTNI	GGTCTC	1 cut(s)	401
BsrDI	GCAATG	4 cut(s)	187, 369, 604, 666
BsrGI	TGTACA	2 cut(s)	171, 334
BsrI	ACTGG	3 cut(s)	412, 575, 907
BssECI	CCNNGG	1 cut(s)	396
BssMI	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
BssNI	GRCGYC	2 cut(s)	159, 354
Bst2UI	CCWGG	1 cut(s)	921
Bst4CI	ACNGT	4 cut(s)	28, 262, 713, 977
Bst6I	CTCTTC	1 cut(s)	615
BstACI	GRCGYC	2 cut(s)	159, 354
BstAUI	TGTACA	2 cut(s)	171, 334
BstC8I	GCNNGC	3 cut(s)	81, 281, 595
BstDEI	CTNAG	1 cut(s)	753
BstDSI	CCRYGG	1 cut(s)	396
BstF5I	GGATG	5 cut(s)	146, 267, 429, 754, 821
BstKTI	GATC	6 cut(s)	220, 403, 480, 699, 798, 882
BstMAI	GTCTC	3 cut(s)	401, 490, 985
BstMBI	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
BstMCI	CGRYCG	1 cut(s)	378
BstMWI	GCNNNNNNNGC	3 cut(s)	85, 308, 455
BstNI	CCWGG	1 cut(s)	921
BstSCI	CCNGG	1 cut(s)	919
BstSFI	CTRYAG	1 cut(s)	930
BstSLI	GKGCMC	2 cut(s)	103, 607
BstV1I	GCAGC	6 cut(s)	45, 289, 292, 295, 470, 541
BstX2I	RGATCY	1 cut(s)	400
BstYI	RGATCY	1 cut(s)	400
BsuI	GTATCC	1 cut(s)	636
BsuRI	GGCC	5 cut(s)	291, 474, 605, 820, 919
BtgI	CCRYGG	1 cut(s)	396
BtsCI	GGATG	5 cut(s)	146, 267, 429, 754, 821
BtsI	GCAGTG	1 cut(s)	838
BtsIMutI	CAGTG	3 cut(s)	294, 642, 838
Cac8I	GCNNGC	3 cut(s)	81, 281, 595
Cfr13I	GGNCC	3 cut(s)	322, 603, 604
Csp6I	GTAC	7 cut(s)	172, 335, 389, 721, 757, 897, 1030
CspCI	CAANNNNNGTGG	2 cut(s)	492, 527
CviAII	CATG	2 cut(s)	887, 952
CviQI	GTAC	7 cut(s)	172, 335, 389, 721, 757, 897, 1030
DdeI	CTNAG	1 cut(s)	753
DpnI	GATC	6 cut(s)	219, 402, 479, 698, 797, 881
DpnII	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
DrdI	GACNNNNNNGTC	1 cut(s)	999
DseDI	GACNNNNNNGTC	1 cut(s)	999
EaeI	YGGCCR	1 cut(s)	818
Eam1104I	CTCTTC	1 cut(s)	615
EarI	CTCTTC	1 cut(s)	615
Eco147I	AGGCCT	2 cut(s)	291, 919
Eco24I	GRGCYC	1 cut(s)	607
Eco31I	GGTCTC	1 cut(s)	401
Eco47I	GGWCC	1 cut(s)	322
Eco57I	CTGAAG	2 cut(s)	516, 1002
Eco88I	CYCGRG	1 cut(s)	767
EcoO109I	RGGNCCY	2 cut(s)	603, 604
EcoRII	CCWGG	1 cut(s)	919
EcoT38I	GRGCYC	1 cut(s)	607
FaeI	CATG	2 cut(s)	890, 955
FaqI	GGGAC	1 cut(s)	919
FatI	CATG	2 cut(s)	886, 951
FbaI	TGATCA	1 cut(s)	879
Fnu4HI	GCNGC	7 cut(s)	59, 303, 306, 309, 459, 555, 840
FokI	GGATG	5 cut(s)	133, 254, 416, 761, 808
FriOI	GRGCYC	1 cut(s)	607
Fsp4HI	GCNGC	7 cut(s)	59, 303, 306, 309, 459, 555, 840
FspBI	CTAG	3 cut(s)	21, 590, 1048
GluI	GCNGC	7 cut(s)	59, 303, 306, 309, 459, 555, 840
GsaI	CCCAGC	1 cut(s)	428
HaeIII	GGCC	5 cut(s)	291, 474, 605, 820, 919
Hin1I	GRCGYC	2 cut(s)	159, 354
Hin1II	CATG	2 cut(s)	890, 955
HinfI	GANTC	2 cut(s)	152, 907
HphI	GGTGA	2 cut(s)	250, 676
Hpy166II	GTNNAC	2 cut(s)	101, 514
Hpy188I	TCNGA	4 cut(s)	151, 157, 808, 826
Hpy188III	TCNNGA	5 cut(s)	379, 404, 700, 767, 769
Hpy8I	GTNNAC	2 cut(s)	101, 514
Hpy99I	CGWCG	3 cut(s)	164, 713, 803
HpyAV	CCTTC	3 cut(s)	540, 663, 821
HpyCH4III	ACNGT	4 cut(s)	28, 262, 713, 977
HpyCH4IV	ACGT	4 cut(s)	159, 354, 633, 789
HpyCH4V	TGCA	7 cut(s)	88, 101, 311, 449, 469, 557, 857
HpyF10VI	GCNNNNNNNGC	3 cut(s)	85, 308, 455
HpyF3I	CTNAG	1 cut(s)	753
HpySE526I	ACGT	4 cut(s)	159, 354, 633, 789
Hsp92I	GRCGYC	2 cut(s)	159, 354
Hsp92II	CATG	2 cut(s)	890, 955
Ksp22I	TGATCA	1 cut(s)	879
Kzo9I	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
LmnI	GCTCC	1 cut(s)	787
Lsp1109I	GCAGC	6 cut(s)	45, 289, 292, 295, 470, 541
LweI	GCATC	6 cut(s)	66, 289, 541, 727, 739, 826
MaeI	CTAG	3 cut(s)	21, 590, 1048
MaeII	ACGT	4 cut(s)	159, 354, 633, 789
MaeIII	GTNAC	1 cut(s)	262
MalI	GATC	6 cut(s)	219, 402, 479, 698, 797, 881
MboI	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
MboII	GAAGA	2 cut(s)	204, 602
MfeI	CAATTG	2 cut(s)	450, 495
MflI	RGATCY	1 cut(s)	400
MhlI	GDGCHC	2 cut(s)	103, 607
MlsI	TGGCCA	1 cut(s)	820
MluCI	AATT	5 cut(s)	139, 201, 450, 495, 874
MluNI	TGGCCA	1 cut(s)	820
MlyI	GAGTC	1 cut(s)	901
MmeI	TCCRAC	3 cut(s)	245, 270, 786
MnlI	CCTC	7 cut(s)	281, 302, 431, 537, 618, 697, 909
Mox20I	TGGCCA	1 cut(s)	820
MscI	TGGCCA	1 cut(s)	820
MseI	TTAA	1 cut(s)	237
Msp20I	TGGCCA	1 cut(s)	820
MspA1I	CMGCKG	1 cut(s)	536
MspR9I	CCNGG	1 cut(s)	921
MunI	CAATTG	2 cut(s)	450, 495
MvaI	CCWGG	1 cut(s)	921
MwoI	GCNNNNNNNGC	3 cut(s)	85, 308, 455
NdeII	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
NlaIII	CATG	2 cut(s)	890, 955
NlaIV	GGNNCC	6 cut(s)	244, 323, 402, 604, 605, 606
NmuCI	GTSAC	1 cut(s)	262
PaeR7I	CTCGAG	1 cut(s)	767
PceI	AGGCCT	2 cut(s)	291, 919
PcsI	WCGNNNNNNNCGW	1 cut(s)	795
PfeI	GAWTC	1 cut(s)	152
PkrI	GCNGC	7 cut(s)	60, 304, 307, 310, 460, 556, 841
PleI	GAGTC	1 cut(s)	901
PpsI	GAGTC	1 cut(s)	901
Psp6I	CCWGG	1 cut(s)	919
PspFI	CCCAGC	1 cut(s)	424
PspGI	CCWGG	1 cut(s)	919
PspN4I	GGNNCC	6 cut(s)	244, 323, 402, 604, 605, 606
PspOMI	GGGCCC	1 cut(s)	603
PspPI	GGNCC	3 cut(s)	322, 603, 604
PsuI	RGATCY	1 cut(s)	400
PvuII	CAGCTG	1 cut(s)	536
RsaI	GTAC	7 cut(s)	173, 336, 390, 722, 758, 898, 1031
RsaNI	GTAC	7 cut(s)	172, 335, 389, 721, 757, 897, 1030
SaqAI	TTAA	1 cut(s)	237
SatI	GCNGC	7 cut(s)	59, 303, 306, 309, 459, 555, 840
Sau3AI	GATC	6 cut(s)	217, 400, 477, 696, 795, 879
Sau96I	GGNCC	3 cut(s)	322, 603, 604
ScaI	AGTACT	1 cut(s)	758
SchI	GAGTC	1 cut(s)	901
ScrFI	CCNGG	1 cut(s)	921
SduI	GDGCHC	2 cut(s)	103, 607
SfaNI	GCATC	6 cut(s)	66, 289, 541, 727, 739, 826
SfcI	CTRYAG	1 cut(s)	930
Sfr274I	CTCGAG	1 cut(s)	767
SinI	GGWCC	1 cut(s)	322
SlaI	CTCGAG	1 cut(s)	767
SmlI	CTYRAG	1 cut(s)	767
SmoI	CTYRAG	1 cut(s)	767
Sse9I	AATT	5 cut(s)	139, 201, 450, 495, 874
SseBI	AGGCCT	2 cut(s)	291, 919
SsiI	CCGC	2 cut(s)	374, 840
SspMI	CTAG	3 cut(s)	21, 590, 1048
StuI	AGGCCT	2 cut(s)	291, 919
StyD4I	CCNGG	1 cut(s)	919
TaaI	ACNGT	4 cut(s)	28, 262, 713, 977
TaiI	ACGT	4 cut(s)	162, 357, 636, 792
TaqI	TCGA	1 cut(s)	768
TaqII	GACCGA	1 cut(s)	989
TasI	AATT	5 cut(s)	139, 201, 450, 495, 874
TatI	WGTACW	3 cut(s)	171, 334, 756
TauI	GCSGC	1 cut(s)	842
TfiI	GAWTC	1 cut(s)	152
Tru1I	TTAA	1 cut(s)	237
Tru9I	TTAA	1 cut(s)	237
TscAI	CASTG	3 cut(s)	301, 649, 838
TseFI	GTSAC	1 cut(s)	262
TseI	GCWGC	6 cut(s)	58, 302, 305, 308, 458, 554
Tsp45I	GTSAC	1 cut(s)	262
TspDTI	ATGAA	4 cut(s)	222, 431, 556, 975
TspGWI	ACGGA	1 cut(s)	413
TspRI	CASTG	3 cut(s)	301, 649, 838
VneI	GTGCAC	1 cut(s)	99
VpaK11BI	GGWCC	1 cut(s)	322
XapI	RAATTY	2 cut(s)	201, 874
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1040
XhoI	CTCGAG	1 cut(s)	767
XspI	CTAG	3 cut(s)	21, 590, 1048
ZraI	GACGTC	2 cut(s)	160, 355
ZrmI	AGTACT	1 cut(s)	758

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.